Regulon of XylR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0186
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - XylR
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.1 Sequence: GTTTGTAAATAGAACTAACAAAC Locus tag: PEPE_0185 Name: xynT Funciton: Xyloside transporter XynT Locus tag: PEPE_0186 Name: xylR Funciton: Xylose repressor XylR, ROK family Locus tag: PEPE_0187 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: PEPE_0188 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	PEPE_0185	xynT	Xyloside transporter XynT
	PEPE_0186	xylR	Xylose repressor XylR, ROK family
	PEPE_0187	xylA	Xylose isomerase (EC 5.3.1.5)
	PEPE_0188	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -182 Score: 5.1 Sequence: GTTTGTTAGTTCTATTTACAAAC Locus tag: PEPE_0184 Name: xylS Funciton: Alpha-xylosidase (EC 3.2.1.-)
	PEPE_0184	xylS	Alpha-xylosidase (EC 3.2.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD