Regulon of XylR in Lactobacillus fermentum IFO 3956

Properties
Regulator type:	Transcription factor
TF locus tag:	LAF_0400
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - XylR
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.1 Sequence: GTTAGTTGTTTTAAAAAACCAAT Locus tag: LAF_0402 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: LAF_0403 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	LAF_0402	xylA	Xylose isomerase (EC 5.3.1.5)
	LAF_0403	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -121 Score: 5.5 Sequence: GTTTGTTTACTAAATAAACTAAC Locus tag: LAF_0405 Name: xynB2 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: LAF_0406 Name: xynT3 Funciton: Xyloside transporter XynT
	LAF_0405	xynB2	Beta-xylosidase (EC 3.2.1.37)
	LAF_0406	xynT3	Xyloside transporter XynT
Position: -90 Score: 5.2 Sequence: GTTAGTTTTTATCAGCAACTAAC Locus tag: LAF_0401 Name: xylT Funciton: D-xylose proton-symporter XylT
	LAF_0401	xylT	D-xylose proton-symporter XylT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD