Regulog FetR - Chloroflexia

Properties
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Chloroflexi
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Roseiflexus sp. RS-1	17	3
Roseiflexus castenholzii DSM 13941	17	3
Herpetosiphon aurantiacus ATCC 23779
Chloroflexus sp. Y-400-fl	16	5
Chloroflexus aggregans DSM 9485	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
fbpA	* Roseiflexus sp. RS-1 Site: position = -157 score = 5.9934 sequence = ATGTTAGAGTAATCTAACAA Gene: RoseRS_2294: Ferric iron ABC transporter, periplasmic-binding protein	* Roseiflexus castenholzii DSM 13941 Site: position = -159 score = 5.50246 sequence = ATGTTAGAGTAACCTAACAC Gene: Rcas_3171: Ferric iron ABC transporter, periplasmic-binding protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1722: Ferric iron ABC transporter, periplasmic-binding protein	* Chloroflexus sp. Y-400-fl Site: position = -55 score = 6.20265 sequence = TTATTAGTGTATACTAATAA Gene: Chy400_0349: Ferric iron ABC transporter, periplasmic-binding protein	* Chloroflexus aggregans DSM 9485 Site: position = -83 score = 5.56503 sequence = ACGTTAGCATATACTAACCC Gene: Cagg_2416: Ferric iron ABC transporter, periplasmic-binding protein	Ferric iron ABC transporter, periplasmic-binding protein
fbpB	Roseiflexus sp. RS-1 Gene: RoseRS_2293: Ferric iron ABC transporter, permease protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3172: Ferric iron ABC transporter, permease protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1721: Ferric iron ABC transporter, permease protein	Chloroflexus sp. Y-400-fl Gene: Chy400_0348: Ferric iron ABC transporter, permease protein	Chloroflexus aggregans DSM 9485 Gene: Cagg_2417: Ferric iron ABC transporter, permease protein	Ferric iron ABC transporter, permease protein
fbpC	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1720: Ferric iron ABC transporter, ATP-binding protein	Chloroflexus sp. Y-400-fl Gene: Chy400_0347: Ferric iron ABC transporter, ATP-binding protein	Chloroflexus aggregans DSM 9485	Ferric iron ABC transporter, ATP-binding protein

CRON 2.
Haur_0321	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0321: hypothetical transporter, MFS superfamily	* Chloroflexus sp. Y-400-fl Site: position = -136 score = 5.79717 sequence = TAATTAGCATACACTAACTA Gene: Chy400_4135: hypothetical transporter, MFS superfamily	Chloroflexus aggregans DSM 9485	hypothetical transporter, MFS superfamily
fepB	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_4136: Iron siderophore ABC transporter, periplasmic component	Chloroflexus aggregans DSM 9485	Iron siderophore ABC transporter, periplasmic component

CRON 3.
COG0716	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	* Chloroflexus sp. Y-400-fl Site: position = -158 score = 6.18424 sequence = TTATTAGCATATACTAACCT Gene: Chy400_0344: flavodoxin	Chloroflexus aggregans DSM 9485	flavodoxin
Chy400_0343	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_0343: hypothetical protein	Chloroflexus aggregans DSM 9485	hypothetical protein
fepB2	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_0342: Iron siderophore ABC transporter, periplasmic component	Chloroflexus aggregans DSM 9485	Iron siderophore ABC transporter, periplasmic component
Chy400_0341	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_0341: hypothetical protein	Chloroflexus aggregans DSM 9485	hypothetical protein

CRON 4.
RoseRS_4469	* Roseiflexus sp. RS-1 Site: position = -141 score = 6.03066 sequence = TTATTAGGATATGCTAACCA Gene: RoseRS_4469: hypothetical protein	* Roseiflexus castenholzii DSM 13941 Site: position = -98 score = 6.32925 sequence = TTATTAGCATATGCTAACAT Gene: Rcas_0821: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0469: hypothetical protein	* Chloroflexus sp. Y-400-fl Site: position = -92 score = 5.81524 sequence = TTATTAGAGTATGCTAACCG Gene: Chy400_0685: hypothetical protein	Chloroflexus aggregans DSM 9485	hypothetical protein
ftr	Roseiflexus sp. RS-1 Gene: RoseRS_4468: High-affinity Fe2+ permease, FTR family	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0820: High-affinity Fe2+ permease, FTR family	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0468: High-affinity Fe2+ permease, FTR family	Chloroflexus sp. Y-400-fl Gene: Chy400_0686: High-affinity Fe2+ permease, FTR family	Chloroflexus aggregans DSM 9485	High-affinity Fe2+ permease, FTR family
RoseRS_4467	Roseiflexus sp. RS-1 Gene: RoseRS_4467: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0819: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein
RoseRS_4466	Roseiflexus sp. RS-1 Gene: RoseRS_4466: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0818: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein

CRON 5.
hmuV	* Roseiflexus sp. RS-1 Site: position = -109 score = 5.96912 sequence = TTATTAGACTATACTAACCA Gene: RoseRS_3564: Heme ABC transporter, ATPase component HmuV	* Roseiflexus castenholzii DSM 13941 Site: position = -123 score = 5.90096 sequence = TTATTAGACTATACTAACTT Gene: Rcas_4373: Heme ABC transporter, ATPase component HmuV	Herpetosiphon aurantiacus ATCC 23779	* Chloroflexus sp. Y-400-fl Site: position = -57 score = 5.78509 sequence = AAATTAGAGTATTCTAATAG Gene: Chy400_2616: Heme ABC transporter, ATPase component HmuV	* Chloroflexus aggregans DSM 9485 Site: position = -57 score = 5.97798 sequence = AAATTAGTATATTCTAACTT Gene: Cagg_3308: Heme ABC transporter, ATPase component HmuV	Heme ABC transporter, ATPase component HmuV
hmuT	Roseiflexus sp. RS-1 Gene: RoseRS_3565: Heme ABC transporter, hemin-binding periplasmic component hmuT	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4372: Heme ABC transporter, hemin-binding periplasmic component hmuT	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_2617: Heme ABC transporter, hemin-binding periplasmic component hmuT	Chloroflexus aggregans DSM 9485 Gene: Cagg_3307: Heme ABC transporter, hemin-binding periplasmic component hmuT	Heme ABC transporter, hemin-binding periplasmic component hmuT
hmuU	Roseiflexus sp. RS-1 Gene: RoseRS_3566: Heme ABC transporter, permease component HmuU	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4371: Heme ABC transporter, permease component HmuU	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_2618: Heme ABC transporter, permease component HmuU	Chloroflexus aggregans DSM 9485 Gene: Cagg_3306: Heme ABC transporter, permease component HmuU	Heme ABC transporter, permease component HmuU
RoseRS_3567	Roseiflexus sp. RS-1 Gene: RoseRS_3567: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4370: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein
RoseRS_0755	Roseiflexus sp. RS-1 Gene: RoseRS_3568: Hypothetical similar to CcmC, putative heme lyase for CcmE	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4369: Hypothetical similar to CcmC, putative heme lyase for CcmE	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Hypothetical similar to CcmC, putative heme lyase for CcmE
RoseRS_3569	Roseiflexus sp. RS-1 Gene: RoseRS_3569: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4368: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein
COG2329	Roseiflexus sp. RS-1 Gene: RoseRS_3570: hypothetical monooxygenase	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4367: hypothetical monooxygenase	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_2619: hypothetical monooxygenase	Chloroflexus aggregans DSM 9485 Gene: Cagg_3305: hypothetical monooxygenase	hypothetical monooxygenase
RoseRS_3571	Roseiflexus sp. RS-1 Gene: RoseRS_3571: Hemin ABC transporter, permease protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4366: Hemin ABC transporter, permease protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Hemin ABC transporter, permease protein
RoseRS_3572	Roseiflexus sp. RS-1 Gene: RoseRS_3572: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4365: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein
RoseRS_3573	Roseiflexus sp. RS-1 Gene: RoseRS_3573: hypothetical protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4364: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	hypothetical protein
fetR	Roseiflexus sp. RS-1 Gene: RoseRS_3574: Ferrous iron dependent repressor, DtxR family	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4363: Ferrous iron dependent repressor, DtxR family	Herpetosiphon aurantiacus ATCC 23779	Chloroflexus sp. Y-400-fl Gene: Chy400_2620: Ferrous iron dependent repressor, DtxR family	Chloroflexus aggregans DSM 9485 Gene: Cagg_3304: Ferrous iron dependent repressor, DtxR family	Ferrous iron dependent repressor, DtxR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog FetR - Chloroflexia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --