Regulon of FetR in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_3304
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	FetR - Chloroflexia
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.6 Sequence: ACGTTAGCATATACTAACCC Locus tag: Cagg_2416 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Cagg_2417 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
	Cagg_2416	fbpA	Ferric iron ABC transporter, periplasmic-binding protein
	Cagg_2417	fbpB	Ferric iron ABC transporter, permease protein
Position: -57 Score: 6 Sequence: AAATTAGTATATTCTAACTT Locus tag: Cagg_3308 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: Cagg_3307 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: Cagg_3306 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: Cagg_3305 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: Cagg_3304 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
	Cagg_3308	hmuV	Heme ABC transporter, ATPase component HmuV
	Cagg_3307	hmuT	Heme ABC transporter, hemin-binding periplasmic component hmuT
	Cagg_3306	hmuU	Heme ABC transporter, permease component HmuU
	Cagg_3305	COG2329	hypothetical monooxygenase
	Cagg_3304	fetR	Ferrous iron dependent repressor, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD