Regulon of FetR in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_3574
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	FetR - Chloroflexia
Statistics of regulated genes:
- Genes	17
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -157 Score: 6 Sequence: ATGTTAGAGTAATCTAACAA Locus tag: RoseRS_2294 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: RoseRS_2293 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
	RoseRS_2294	fbpA	Ferric iron ABC transporter, periplasmic-binding protein
	RoseRS_2293	fbpB	Ferric iron ABC transporter, permease protein
Position: -141 Score: 6 Sequence: TTATTAGGATATGCTAACCA Locus tag: RoseRS_4469 Name: RoseRS_4469 Funciton: hypothetical protein Locus tag: RoseRS_4468 Name: ftr Funciton: High-affinity Fe2+ permease, FTR family Locus tag: RoseRS_4467 Name: RoseRS_4467 Funciton: hypothetical protein Locus tag: RoseRS_4466 Name: RoseRS_4466 Funciton: hypothetical protein
	RoseRS_4469	RoseRS_4469	hypothetical protein
	RoseRS_4468	ftr	High-affinity Fe2+ permease, FTR family
	RoseRS_4467	RoseRS_4467	hypothetical protein
	RoseRS_4466	RoseRS_4466	hypothetical protein
Position: -109 Score: 6 Sequence: TTATTAGACTATACTAACCA Locus tag: RoseRS_3564 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: RoseRS_3565 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: RoseRS_3566 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: RoseRS_3567 Name: RoseRS_3567 Funciton: hypothetical protein Locus tag: RoseRS_3568 Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE Locus tag: RoseRS_3569 Name: RoseRS_3569 Funciton: hypothetical protein Locus tag: RoseRS_3570 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: RoseRS_3571 Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein Locus tag: RoseRS_3572 Name: RoseRS_3572 Funciton: hypothetical protein Locus tag: RoseRS_3573 Name: RoseRS_3573 Funciton: hypothetical protein Locus tag: RoseRS_3574 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
	RoseRS_3564	hmuV	Heme ABC transporter, ATPase component HmuV
	RoseRS_3565	hmuT	Heme ABC transporter, hemin-binding periplasmic component hmuT
	RoseRS_3566	hmuU	Heme ABC transporter, permease component HmuU
	RoseRS_3567	RoseRS_3567	hypothetical protein
	RoseRS_3568	RoseRS_0755	Hypothetical similar to CcmC, putative heme lyase for CcmE
	RoseRS_3569	RoseRS_3569	hypothetical protein
	RoseRS_3570	COG2329	hypothetical monooxygenase
	RoseRS_3571	RoseRS_3571	Hemin ABC transporter, permease protein
	RoseRS_3572	RoseRS_3572	hypothetical protein
	RoseRS_3573	RoseRS_3573	hypothetical protein
	RoseRS_3574	fetR	Ferrous iron dependent repressor, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FetR in Roseiflexus sp. RS-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --