Orthologous regulated operons containing fbpB gene

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -83 Score: 5.56503 Sequence: ACGTTAGCATATACTAACCC Locus tag: Cagg_2416 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Cagg_2417 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
fbpA-fbpB	-83	5.6	ACGTTAGCATATACTAACCC	Cagg_2416
Chloroflexus sp. Y-400-fl
Position: -55 Score: 6.20265 Sequence: TTATTAGTGTATACTAATAA Locus tag: Chy400_0349 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Chy400_0348 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: Chy400_0347 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-55	6.2	TTATTAGTGTATACTAATAA	Chy400_0349
Roseiflexus castenholzii DSM 13941
Position: -159 Score: 5.50246 Sequence: ATGTTAGAGTAACCTAACAC Locus tag: Rcas_3171 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Rcas_3172 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
fbpA-fbpB	-159	5.5	ATGTTAGAGTAACCTAACAC	Rcas_3171
Roseiflexus sp. RS-1
Position: -157 Score: 5.9934 Sequence: ATGTTAGAGTAATCTAACAA Locus tag: RoseRS_2294 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: RoseRS_2293 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
fbpA-fbpB	-157	6	ATGTTAGAGTAATCTAACAA	RoseRS_2294

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --