Regulon of FetR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_2620
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	FetR - Chloroflexia
Statistics of regulated genes:
- Genes	16
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 5.8 Sequence: TAATTAGCATACACTAACTA Locus tag: Chy400_4135 Name: Haur_0321 Funciton: hypothetical transporter, MFS superfamily Locus tag: Chy400_4136 Name: fepB Funciton: Iron siderophore ABC transporter, periplasmic component
	Chy400_4135	Haur_0321	hypothetical transporter, MFS superfamily
	Chy400_4136	fepB	Iron siderophore ABC transporter, periplasmic component
Position: -158 Score: 6.2 Sequence: TTATTAGCATATACTAACCT Locus tag: Chy400_0344 Name: COG0716 Funciton: flavodoxin Locus tag: Chy400_0343 Name: null Funciton: hypothetical protein Locus tag: Chy400_0342 Name: fepB2 Funciton: Iron siderophore ABC transporter, periplasmic component Locus tag: Chy400_0341 Name: null Funciton: hypothetical protein
	Chy400_0344	COG0716	flavodoxin
	Chy400_0343		hypothetical protein
	Chy400_0342	fepB2	Iron siderophore ABC transporter, periplasmic component
	Chy400_0341		hypothetical protein
Position: -55 Score: 6.2 Sequence: TTATTAGTGTATACTAATAA Locus tag: Chy400_0349 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Chy400_0348 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: Chy400_0347 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	Chy400_0349	fbpA	Ferric iron ABC transporter, periplasmic-binding protein
	Chy400_0348	fbpB	Ferric iron ABC transporter, permease protein
	Chy400_0347	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -57 Score: 5.8 Sequence: AAATTAGAGTATTCTAATAG Locus tag: Chy400_2616 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: Chy400_2617 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: Chy400_2618 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: Chy400_2619 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: Chy400_2620 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
	Chy400_2616	hmuV	Heme ABC transporter, ATPase component HmuV
	Chy400_2617	hmuT	Heme ABC transporter, hemin-binding periplasmic component hmuT
	Chy400_2618	hmuU	Heme ABC transporter, permease component HmuU
	Chy400_2619	COG2329	hypothetical monooxygenase
	Chy400_2620	fetR	Ferrous iron dependent repressor, DtxR family
Position: -92 Score: 5.8 Sequence: TTATTAGAGTATGCTAACCG Locus tag: Chy400_0685 Name: RoseRS_4469 Funciton: hypothetical protein Locus tag: Chy400_0686 Name: ftr Funciton: High-affinity Fe2+ permease, FTR family
	Chy400_0685	RoseRS_4469	hypothetical protein
	Chy400_0686	ftr	High-affinity Fe2+ permease, FTR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FetR in Chloroflexus sp. Y-400-fl

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --