Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ftr gene

Properties
Regulog: FetR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Chloroflexi
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -92
Score: 5.81524
Sequence: TTATTAGAGTATGCTAACCG
Locus tag: Chy400_0685
Name: RoseRS_4469
Funciton: hypothetical protein
Locus tag: Chy400_0686
Name: ftr
Funciton: High-affinity Fe2+ permease, FTR family
RoseRS_4469-ftr -92 5.8 TTATTAGAGTATGCTAACCG Chy400_0685
Roseiflexus castenholzii DSM 13941
Position: -98
Score: 6.32925
Sequence: TTATTAGCATATGCTAACAT
Locus tag: Rcas_0821
Name: RoseRS_4469
Funciton: hypothetical protein
Locus tag: Rcas_0820
Name: ftr
Funciton: High-affinity Fe2+ permease, FTR family
Locus tag: Rcas_0819
Name: RoseRS_4467
Funciton: hypothetical protein
Locus tag: Rcas_0818
Name: RoseRS_4466
Funciton: hypothetical protein
RoseRS_4469-ftr-RoseRS_4467-RoseRS_4466 -98 6.3 TTATTAGCATATGCTAACAT Rcas_0821
Roseiflexus sp. RS-1
Position: -141
Score: 6.03066
Sequence: TTATTAGGATATGCTAACCA
Locus tag: RoseRS_4469
Name: RoseRS_4469
Funciton: hypothetical protein
Locus tag: RoseRS_4468
Name: ftr
Funciton: High-affinity Fe2+ permease, FTR family
Locus tag: RoseRS_4467
Name: RoseRS_4467
Funciton: hypothetical protein
Locus tag: RoseRS_4466
Name: RoseRS_4466
Funciton: hypothetical protein
RoseRS_4469-ftr-RoseRS_4467-RoseRS_4466 -141 6 TTATTAGGATATGCTAACCA RoseRS_4469