Regulon of FetR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_4363
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	FetR - Chloroflexia
Statistics of regulated genes:
- Genes	17
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 5.5 Sequence: ATGTTAGAGTAACCTAACAC Locus tag: Rcas_3171 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic-binding protein Locus tag: Rcas_3172 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
	Rcas_3171	fbpA	Ferric iron ABC transporter, periplasmic-binding protein
	Rcas_3172	fbpB	Ferric iron ABC transporter, permease protein
Position: -98 Score: 6.3 Sequence: TTATTAGCATATGCTAACAT Locus tag: Rcas_0821 Name: RoseRS_4469 Funciton: hypothetical protein Locus tag: Rcas_0820 Name: ftr Funciton: High-affinity Fe2+ permease, FTR family Locus tag: Rcas_0819 Name: RoseRS_4467 Funciton: hypothetical protein Locus tag: Rcas_0818 Name: RoseRS_4466 Funciton: hypothetical protein
	Rcas_0821	RoseRS_4469	hypothetical protein
	Rcas_0820	ftr	High-affinity Fe2+ permease, FTR family
	Rcas_0819	RoseRS_4467	hypothetical protein
	Rcas_0818	RoseRS_4466	hypothetical protein
Position: -123 Score: 5.9 Sequence: TTATTAGACTATACTAACTT Locus tag: Rcas_4373 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: Rcas_4372 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: Rcas_4371 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: Rcas_4370 Name: RoseRS_3567 Funciton: hypothetical protein Locus tag: Rcas_4369 Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE Locus tag: Rcas_4368 Name: RoseRS_3569 Funciton: hypothetical protein Locus tag: Rcas_4367 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: Rcas_4366 Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein Locus tag: Rcas_4365 Name: RoseRS_3572 Funciton: hypothetical protein Locus tag: Rcas_4364 Name: RoseRS_3573 Funciton: hypothetical protein Locus tag: Rcas_4363 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
	Rcas_4373	hmuV	Heme ABC transporter, ATPase component HmuV
	Rcas_4372	hmuT	Heme ABC transporter, hemin-binding periplasmic component hmuT
	Rcas_4371	hmuU	Heme ABC transporter, permease component HmuU
	Rcas_4370	RoseRS_3567	hypothetical protein
	Rcas_4369	RoseRS_0755	Hypothetical similar to CcmC, putative heme lyase for CcmE
	Rcas_4368	RoseRS_3569	hypothetical protein
	Rcas_4367	COG2329	hypothetical monooxygenase
	Rcas_4366	RoseRS_3571	Hemin ABC transporter, permease protein
	Rcas_4365	RoseRS_3572	hypothetical protein
	Rcas_4364	RoseRS_3573	hypothetical protein
	Rcas_4363	fetR	Ferrous iron dependent repressor, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FetR in Roseiflexus castenholzii DSM 13941

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --