Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	5	2
Chloroflexus sp. Y-400-fl	4	1
Roseiflexus castenholzii DSM 13941	5	2
Herpetosiphon aurantiacus ATCC 23779	4	1
Roseiflexus sp. RS-1	8	3

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
mntR	Chloroflexus aggregans DSM 9485 Gene: Cagg_1173: Mn-dependent transcriptional regulator MntR, DtxR family	Chloroflexus sp. Y-400-fl Gene: Chy400_0107: Mn-dependent transcriptional regulator MntR, DtxR family	* Roseiflexus castenholzii DSM 13941 Site: position = -9 score = 5.84772 sequence = GTTTTAGGAATGCCTAAATA Gene: Rcas_3322: Mn-dependent transcriptional regulator MntR, DtxR family	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4031: Mn-dependent transcriptional regulator MntR, DtxR family	* Roseiflexus sp. RS-1 Site: position = -29 score = 5.49011 sequence = GTTTTAGGTCTACCTAAATT Gene: RoseRS_3986: Mn-dependent transcriptional regulator MntR, DtxR family	Mn-dependent transcriptional regulator MntR, DtxR family
CRON 2.
mntH	* Chloroflexus aggregans DSM 9485 Site: position = -74 score = 5.57948 sequence = AATTTAGGGAATACTAAAAA Gene: Cagg_1154: Manganese transport protein MntH, NRAMP family	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Manganese transport protein MntH, NRAMP family
CRON 3.
mntA	* Chloroflexus aggregans DSM 9485 Site: position = -38 score = 6.03137 sequence = ATTTTAGGTTAGGCTAAAAT Gene: Cagg_3553: Manganese ABC transporter, periplasmic-binding protein	* Chloroflexus sp. Y-400-fl Site: position = -40 score = 5.82405 sequence = GATTTAGGTAAGGCTAAAAT Gene: Chy400_0210: Manganese ABC transporter, periplasmic-binding protein	* Roseiflexus castenholzii DSM 13941 Site: position = -55 score = 5.90607 sequence = ATTTTAGGATTTCCAAAATT Gene: Rcas_1724: Manganese ABC transporter, periplasmic-binding protein	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -51 score = 5.75184 sequence = CTTTTAGGTATGCCTAAATA Gene: Haur_4030: Manganese ABC transporter, periplasmic-binding protein	* Roseiflexus sp. RS-1 Site: position = -42 score = 5.63839 sequence = GATTTAGGCAAGACAAAATT Gene: RoseRS_3070: Manganese ABC transporter, periplasmic-binding protein	Manganese ABC transporter, periplasmic-binding protein
mntB	Chloroflexus aggregans DSM 9485 Gene: Cagg_3554: Manganese ABC transporter, ATP-binding protein	Chloroflexus sp. Y-400-fl Gene: Chy400_0209: Manganese ABC transporter, ATP-binding protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1723: Manganese ABC transporter, ATP-binding protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4029: Manganese ABC transporter, ATP-binding protein	Roseiflexus sp. RS-1 Gene: RoseRS_3069: Manganese ABC transporter, ATP-binding protein	Manganese ABC transporter, ATP-binding protein
mntC	Chloroflexus aggregans DSM 9485 Gene: Cagg_3555: Manganese ABC transporter, inner membrane permease protein	Chloroflexus sp. Y-400-fl Gene: Chy400_0208: Manganese ABC transporter, inner membrane permease protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1722: Manganese ABC transporter, inner membrane permease protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4028: Manganese ABC transporter, inner membrane permease protein	Roseiflexus sp. RS-1 Gene: RoseRS_3068: Manganese ABC transporter, inner membrane permease protein	Manganese ABC transporter, inner membrane permease protein
mntD	Chloroflexus aggregans DSM 9485 Gene: Cagg_3556: Manganese ABC transporter, inner membrane permease protein	Chloroflexus sp. Y-400-fl Gene: Chy400_0207: Manganese ABC transporter, inner membrane permease protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1721: Manganese ABC transporter, inner membrane permease protein	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4027: Manganese ABC transporter, inner membrane permease protein	Roseiflexus sp. RS-1 Gene: RoseRS_3067: Manganese ABC transporter, inner membrane permease protein	Manganese ABC transporter, inner membrane permease protein
CRON 4.
MntR2	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus sp. RS-1 Site: position = -85 score = 6.26236 sequence = ATTTTAGGAATGCCTAAATT Gene: RoseRS_4512: Mn-dependent transcriptional regulator MntR, DtxR family	Mn-dependent transcriptional regulator MntR, DtxR family
feoB1	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1 Gene: RoseRS_4511: Ferrous iron transport protein B	Ferrous iron transport protein B
feoB2	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1 Gene: RoseRS_4510: Ferrous iron transport protein B	Ferrous iron transport protein B

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD