Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MntR2 gene

Properties
Regulog: MntR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Chloroflexi
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseiflexus sp. RS-1
Position: -85
Score: 6.26236
Sequence: ATTTTAGGAATGCCTAAATT
Locus tag: RoseRS_4512
Name: MntR2
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
Locus tag: RoseRS_4511
Name: feoB1
Funciton: Ferrous iron transport protein B
Locus tag: RoseRS_4510
Name: feoB2
Funciton: Ferrous iron transport protein B
MntR2-feoB1-feoB2 -85 6.3 ATTTTAGGAATGCCTAAATT RoseRS_4512
© 2009-2020 RegPrecise