Regulon of MntR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_3322
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -9 Score: 5.8 Sequence: GTTTTAGGAATGCCTAAATA Locus tag: Rcas_3322 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	Rcas_3322	mntR	Mn-dependent transcriptional regulator MntR, DtxR family
Position: -55 Score: 5.9 Sequence: ATTTTAGGATTTCCAAAATT Locus tag: Rcas_1724 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Rcas_1723 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Rcas_1722 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Rcas_1721 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
	Rcas_1724	mntA	Manganese ABC transporter, periplasmic-binding protein
	Rcas_1723	mntB	Manganese ABC transporter, ATP-binding protein
	Rcas_1722	mntC	Manganese ABC transporter, inner membrane permease protein
	Rcas_1721	mntD	Manganese ABC transporter, inner membrane permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD