Regulon of MntR in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_1173
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.6 Sequence: AATTTAGGGAATACTAAAAA Locus tag: Cagg_1154 Name: mntH Funciton: Manganese transport protein MntH, NRAMP family
	Cagg_1154	mntH	Manganese transport protein MntH, NRAMP family
Position: -38 Score: 6 Sequence: ATTTTAGGTTAGGCTAAAAT Locus tag: Cagg_3553 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Cagg_3554 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Cagg_3555 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Cagg_3556 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
	Cagg_3553	mntA	Manganese ABC transporter, periplasmic-binding protein
	Cagg_3554	mntB	Manganese ABC transporter, ATP-binding protein
	Cagg_3555	mntC	Manganese ABC transporter, inner membrane permease protein
	Cagg_3556	mntD	Manganese ABC transporter, inner membrane permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD