Regulon of MntR in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type:	Transcription factor
TF locus tag:	Haur_4031
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Chloroflexia
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.8 Sequence: CTTTTAGGTATGCCTAAATA Locus tag: Haur_4030 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Haur_4029 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Haur_4028 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Haur_4027 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
	Haur_4030	mntA	Manganese ABC transporter, periplasmic-binding protein
	Haur_4029	mntB	Manganese ABC transporter, ATP-binding protein
	Haur_4028	mntC	Manganese ABC transporter, inner membrane permease protein
	Haur_4027	mntD	Manganese ABC transporter, inner membrane permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD