Regulon of MntR in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_3986
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Chloroflexia
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 5.5 Sequence: GTTTTAGGTCTACCTAAATT Locus tag: RoseRS_3986 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	RoseRS_3986	mntR	Mn-dependent transcriptional regulator MntR, DtxR family
Position: -85 Score: 6.3 Sequence: ATTTTAGGAATGCCTAAATT Locus tag: RoseRS_4512 Name: MntR2 Funciton: Mn-dependent transcriptional regulator MntR, DtxR family Locus tag: RoseRS_4511 Name: feoB1 Funciton: Ferrous iron transport protein B Locus tag: RoseRS_4510 Name: feoB2 Funciton: Ferrous iron transport protein B
	RoseRS_4512	MntR2	Mn-dependent transcriptional regulator MntR, DtxR family
	RoseRS_4511	feoB1	Ferrous iron transport protein B
	RoseRS_4510	feoB2	Ferrous iron transport protein B
Position: -42 Score: 5.6 Sequence: GATTTAGGCAAGACAAAATT Locus tag: RoseRS_3070 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RoseRS_3069 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RoseRS_3068 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: RoseRS_3067 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
	RoseRS_3070	mntA	Manganese ABC transporter, periplasmic-binding protein
	RoseRS_3069	mntB	Manganese ABC transporter, ATP-binding protein
	RoseRS_3068	mntC	Manganese ABC transporter, inner membrane permease protein
	RoseRS_3067	mntD	Manganese ABC transporter, inner membrane permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD