Statistics of regulated genes

Genome	Genes	Operons
Haemophilus influenzae Rd KW20	11	9
Aggregatibacter aphrophilus NJ8700	11	9
Pasteurella multocida subsp. multocida str. Pm70	11	9
Mannheimia succiniciproducens MBEL55E	10	8
Actinobacillus succinogenes 130Z	10	8
Haemophilus somnus 2336	10	8
Actinobacillus pleuropneumoniae serovar 7 str. AP76	9	7
Haemophilus ducreyi 35000HP	11	8
Haemophilus parasuis SH0165	8	7

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
ruvA	* Haemophilus influenzae Rd KW20 Site: position = -64 score = 4.67357 sequence = AACTGGATGTTCGTCCAGTT Gene: HI0313: Holliday junction DNA helicase RuvA	* Aggregatibacter aphrophilus NJ8700 Site: position = -66 score = 5.6256 sequence = AACTGGATATTTATCCAGTT Gene: NT05HA_1353: Holliday junction DNA helicase RuvA	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -65 score = 5.01169 sequence = AACTGGATGTTCATCCAGTT Gene: PM0977: Holliday junction DNA helicase RuvA	* Mannheimia succiniciproducens MBEL55E Site: position = -65 score = 5.04246 sequence = AACTGGTTATCTATCCAGTT Gene: MS0712: Holliday junction DNA helicase RuvA	* Actinobacillus succinogenes 130Z Site: position = -60 score = 4.07158 sequence = AGCTGTTGTTTTATTCAGTT Gene: Asuc_1800: Holliday junction DNA helicase RuvA	* Haemophilus somnus 2336 Site: position = -65 score = 5.6256 sequence = AACTGGATATTTATCCAGTT Gene: HSM_0142: Holliday junction DNA helicase RuvA	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0285: Holliday junction DNA helicase RuvA	* Haemophilus ducreyi 35000HP Site: position = -106 score = 4.97069 sequence = GCCTGTTTTTTTATACAGTT Gene: HD1758: Holliday junction DNA helicase RuvA	Haemophilus parasuis SH0165 Gene: HAPS_1346: Holliday junction DNA helicase RuvA	Holliday junction DNA helicase RuvA
ruvB	Haemophilus influenzae Rd KW20 Gene: HI0312: Holliday junction DNA helicase RuvB	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1352: Holliday junction DNA helicase RuvB	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0976: Holliday junction DNA helicase RuvB	Mannheimia succiniciproducens MBEL55E Gene: MS0713: Holliday junction DNA helicase RuvB	Actinobacillus succinogenes 130Z Gene: Asuc_1799: Holliday junction DNA helicase RuvB	Haemophilus somnus 2336 Gene: HSM_0143: Holliday junction DNA helicase RuvB	2 Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0286: Holliday junction DNA helicase RuvB Gene: APP7_0287: Holliday junction DNA helicase RuvB	Haemophilus ducreyi 35000HP Gene: HD1757: Holliday junction DNA helicase RuvB	Haemophilus parasuis SH0165 Gene: HAPS_0995: Holliday junction DNA helicase RuvB	Holliday junction DNA helicase RuvB
CRON 2.
lexA	* Haemophilus influenzae Rd KW20 Site: position = -46 score = 5.20869 sequence = ATCTGTATACAATACCAGTT Site: position = -26 score = 5.03613 sequence = ATCTGTGTTTAAAAACAGGA Gene: HI0749: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Aggregatibacter aphrophilus NJ8700 Site: position = -28 score = 4.87744 sequence = TCATGTATATATTAACAGGA Site: position = -50 score = 5.24265 sequence = TTCTGTATATAATACCAGTC Gene: NT05HA_1581: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -47 score = 5.82771 sequence = TTCTGTATATAATAACAGTT Site: position = -26 score = 5.34762 sequence = TTCTGTATAAAAAAACAGGG Gene: PM1181: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Mannheimia succiniciproducens MBEL55E Site: position = -11 score = 4.5925 sequence = TCCTGTATATAATGTCAGCA Site: position = 9 score = 5.09601 sequence = TTCTGTACAAAAAAACAGGG Gene: MS0744: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Actinobacillus succinogenes 130Z Site: position = -46 score = 4.43648 sequence = AACTGTATAGAATATCAATC Gene: Asuc_0877: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Haemophilus somnus 2336 Site: position = -26 score = 5.42829 sequence = TTCTGTATATAAAAACAGGG Site: position = -47 score = 4.88961 sequence = TTCTGTATATAATATCATAT Gene: HSM_0711: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -49 score = 5.31446 sequence = TACTGTATATAATAACAAAA Site: position = -28 score = 4.95833 sequence = ATCTGTATATAAAGACAGCG Gene: APP7_1165: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Haemophilus ducreyi 35000HP Site: position = -28 score = 5.45583 sequence = TTCTGTATATAAAGACAGTG Site: position = -50 score = 5.31446 sequence = TACTGTATATAATAACACAA Gene: HD0545: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Haemophilus parasuis SH0165 Site: position = -28 score = 5.45583 sequence = TTCTGTATATAAAGACAGTG Site: position = -50 score = 4.70142 sequence = TACTGTATATAATGTCATAA Gene: HAPS_0014: SOS-response repressor and protease LexA (EC 3.4.21.88)	SOS-response repressor and protease LexA (EC 3.4.21.88)
mutH	Haemophilus influenzae Rd KW20 Gene: HI0403: DNA mismatch repair endonuclease MutH	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0157: DNA mismatch repair endonuclease MutH	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1067: DNA mismatch repair endonuclease MutH	Mannheimia succiniciproducens MBEL55E Gene: MS0635: DNA mismatch repair endonuclease MutH	Actinobacillus succinogenes 130Z Gene: Asuc_1903: DNA mismatch repair endonuclease MutH	Haemophilus somnus 2336 Gene: HSM_0474: DNA mismatch repair endonuclease MutH	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1166: DNA mismatch repair endonuclease MutH	Haemophilus ducreyi 35000HP Gene: HD0544: DNA mismatch repair endonuclease MutH	Haemophilus parasuis SH0165 Gene: HAPS_1358: DNA mismatch repair endonuclease MutH	DNA mismatch repair endonuclease MutH
CRON 3.
recA	* Haemophilus influenzae Rd KW20 Site: position = -60 score = 5.12711 sequence = ACCTGTACATCAATACAGAT Gene: HI0600: Recombinase A	* Aggregatibacter aphrophilus NJ8700 Site: position = -67 score = 6.07336 sequence = TACTGTATATTAATACAGTT Gene: NT05HA_1941: Recombinase A	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -66 score = 5.55974 sequence = TACTGTTTATTCATACAGTT Gene: PM1817: Recombinase A	* Mannheimia succiniciproducens MBEL55E Site: position = -69 score = 5.76786 sequence = TACTGTATATTATACCAGTT Gene: MS2243: Recombinase A	* Actinobacillus succinogenes 130Z Site: position = -63 score = 5.18491 sequence = TACTGTGTTTTATACCAGTT Gene: Asuc_0261: Recombinase A	* Haemophilus somnus 2336 Site: position = -66 score = 5.20804 sequence = CACTGTATGTGAATACAGTA Gene: HSM_0315: Recombinase A	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -86 score = 5.30369 sequence = AACTGTATAAGTAAACACTA Gene: APP7_1202: Recombinase A	* Haemophilus ducreyi 35000HP Site: position = -84 score = 5.30369 sequence = AACTGTATAAGTAAACACTA Gene: HD0410: Recombinase A	* Haemophilus parasuis SH0165 Site: position = -84 score = 5.26607 sequence = AACTGTATGGTTAAACAGTA Gene: HAPS_1186: Recombinase A	Recombinase A
recX	Haemophilus influenzae Rd KW20 Gene: HI0599: Regulatory protein RecX	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1940: Regulatory protein RecX	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1816: Regulatory protein RecX	Mannheimia succiniciproducens MBEL55E Gene: MS2242: Regulatory protein RecX	Actinobacillus succinogenes 130Z Gene: Asuc_0260: Regulatory protein RecX	Haemophilus somnus 2336 Gene: HSM_0314: Regulatory protein RecX	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1201: Regulatory protein RecX	Haemophilus ducreyi 35000HP Gene: HD0411: Regulatory protein RecX	Haemophilus parasuis SH0165 Gene: HAPS_1185: Regulatory protein RecX	Regulatory protein RecX
CRON 4.
recN	* Haemophilus influenzae Rd KW20 Site: position = -55 score = 5.06791 sequence = TACTGTAAATTAAGTCAGTT Gene: HI0070: DNA repair protein RecN	* Aggregatibacter aphrophilus NJ8700 Site: position = -55 score = 6.10257 sequence = TACTGTATATTAAAACAGTA Gene: NT05HA_1273: DNA repair protein RecN	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -56 score = 6.23186 sequence = TACTGTATATAAAAACAGTT Gene: PM0332: DNA repair protein RecN	* Mannheimia succiniciproducens MBEL55E Site: position = -54 score = 5.45437 sequence = TACTGTATAAAAAAACATAA Gene: MS0741: DNA repair protein RecN	* Actinobacillus succinogenes 130Z Site: position = -34 score = 4.21735 sequence = TATAATATATTTATACAGTA Gene: Asuc_0884: DNA repair protein RecN	* Haemophilus somnus 2336 Site: position = -57 score = 5.59769 sequence = TACTGTATATAAAAACATAT Site: position = -33 score = 5.22101 sequence = AATTGTATTTATATACAGTA Gene: HSM_0991: DNA repair protein RecN	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -61 score = 5.57638 sequence = TACTGTTCAAAAAAACAGTA Gene: APP7_0025: DNA repair protein RecN	* Haemophilus ducreyi 35000HP Site: position = -42 score = 4.95411 sequence = TACTATATATCTATACAGAA Site: position = -63 score = 5.82799 sequence = TACTGTTTAAAAAAACAGTA Gene: HD0815: DNA repair protein RecN	* Haemophilus parasuis SH0165 Site: position = -61 score = 5.74269 sequence = TACTGTGTATAAAAACAGTG Site: position = -40 score = 4.63347 sequence = TACTATATACTCATACAGTG Gene: HAPS_1355: DNA repair protein RecN	DNA repair protein RecN
CRON 5.
mfd	* Haemophilus influenzae Rd KW20 Site: position = -96 score = 5.63072 sequence = AACTGTTTTTTTAAACAGTT Gene: HI1258: Transcription-repair coupling factor (superfamily II helicase)	* Aggregatibacter aphrophilus NJ8700 Site: position = -86 score = 4.77276 sequence = CACTGTTTTTTTATACAGAC Gene: NT05HA_0196: Transcription-repair coupling factor (superfamily II helicase)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -101 score = 4.37518 sequence = TACTGGCTTTTTATACAGAC Gene: PM1041: Transcription-repair coupling factor (superfamily II helicase)	Mannheimia succiniciproducens MBEL55E Gene: MS0216: Transcription-repair coupling factor (superfamily II helicase)	Actinobacillus succinogenes 130Z Gene: Asuc_0557: Transcription-repair coupling factor (superfamily II helicase)	Haemophilus somnus 2336 Gene: HSM_1578: Transcription-repair coupling factor (superfamily II helicase)	2 Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1391: Transcription-repair coupling factor (superfamily II helicase) Gene: APP7_1390: Transcription-repair coupling factor (superfamily II helicase)	Haemophilus ducreyi 35000HP Gene: HD0975: Transcription-repair coupling factor (superfamily II helicase)	Haemophilus parasuis SH0165 Gene: HAPS_2079: Transcription-repair coupling factor (superfamily II helicase)	Transcription-repair coupling factor (superfamily II helicase)
CRON 6.
uvrD	* Haemophilus influenzae Rd KW20 Site: position = -32 score = 5.54567 sequence = AACTGTAAATTTAAACAGAT Gene: HI1188: ATP-dependent DNA helicase II	* Aggregatibacter aphrophilus NJ8700 Site: position = -36 score = 5.30758 sequence = GCCTGTACAAAAAAACAGTA Gene: NT05HA_1086: ATP-dependent DNA helicase II	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -142 score = 6.15118 sequence = TACTGTATAAAAAAACAGTT Gene: PM0411: ATP-dependent DNA helicase II	* Mannheimia succiniciproducens MBEL55E Site: position = -31 score = 5.1368 sequence = CCCTGTAAAAATAAACAGAT Gene: MS1368: ATP-dependent DNA helicase II	* Actinobacillus succinogenes 130Z Site: position = -30 score = 4.83202 sequence = TAGTGTAAATTTAAACAGAT Gene: Asuc_1268: ATP-dependent DNA helicase II	* Haemophilus somnus 2336 Site: position = -31 score = 5.99839 sequence = AACTGTATAAAAACACAGTT Gene: HSM_1774: ATP-dependent DNA helicase II	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -38 score = 5.10612 sequence = AACTGTATAAACGAACATTA Gene: APP7_1377: ATP-dependent DNA helicase II	* Haemophilus ducreyi 35000HP Site: position = -39 score = 4.82316 sequence = CACTGTATAAATGCACATTG Gene: HD1032: ATP-dependent DNA helicase II	* Haemophilus parasuis SH0165 Site: position = -30 score = 4.9273 sequence = CACTGTATAAAATCACATAA Gene: HAPS_1067: ATP-dependent DNA helicase II	ATP-dependent DNA helicase II
CRON 7.
uvrA	* Haemophilus influenzae Rd KW20 Site: position = -80 score = 5.19475 sequence = AACTGGATATTTGCACAGAT Gene: HI0249: Excinuclease ABC subunit A	* Aggregatibacter aphrophilus NJ8700 Site: position = -79 score = 5.39886 sequence = AACTGGATATTTGCACAGTT Gene: NT05HA_2208: Excinuclease ABC subunit A	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -79 score = 5.39886 sequence = AACTGGATATTTGCACAGTT Gene: PM1951: Excinuclease ABC subunit A	* Mannheimia succiniciproducens MBEL55E Site: position = -79 score = 5.55078 sequence = AACTGGATATTTTCACAGTT Gene: MS0586: Excinuclease ABC subunit A	* Actinobacillus succinogenes 130Z Site: position = -77 score = 5.0615 sequence = CACTGAATATTTTAACAGAT Gene: Asuc_1879: Excinuclease ABC subunit A	* Haemophilus somnus 2336 Site: position = -97 score = 5.39886 sequence = AACTGGATATTTGCACAGTT Gene: HSM_1049: Excinuclease ABC subunit A	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0844: Excinuclease ABC subunit A	Haemophilus ducreyi 35000HP Gene: HD1286: Excinuclease ABC subunit A	Haemophilus parasuis SH0165 Gene: HAPS_0371: Excinuclease ABC subunit A	Excinuclease ABC subunit A
CRON 8.
radA	Haemophilus influenzae Rd KW20 Gene: HI1597: DNA repair protein RadA	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0319: DNA repair protein RadA	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0252: DNA repair protein RadA	Mannheimia succiniciproducens MBEL55E Gene: MS2306: DNA repair protein RadA	Actinobacillus succinogenes 130Z Gene: Asuc_1080: DNA repair protein RadA	Haemophilus somnus 2336 Gene: HSM_0374: DNA repair protein RadA	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = 44 score = 4.86227 sequence = AGCTGTTTATTTACTCAGTA Gene: APP7_0940: DNA repair protein RadA	* Haemophilus ducreyi 35000HP Site: position = -65 score = 4.64684 sequence = GCCTGTGTATTTAGTCAGTA Gene: HD1121: DNA repair protein RadA	* Haemophilus parasuis SH0165 Site: position = -67 score = 4.87242 sequence = CCCTGTGCATTTACACAGTG Gene: HAPS_2014: DNA repair protein RadA	DNA repair protein RadA
CRON 9.
impA	* Haemophilus influenzae Rd KW20 Site: position = -88 score = 4.87716 sequence = CCCTGTATGAAATATCAGTA Site: position = -62 score = 4.88833 sequence = AACTGTACAAAAAAACAAGG Gene: HI1546: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Aggregatibacter aphrophilus NJ8700 Site: position = -37 score = 5.5587 sequence = CACTGTACAAAAACACAGTT Site: position = -63 score = 5.7005 sequence = TACTGTATATAACAACAGTA Gene: NT05HA_0999: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -38 score = 5.76772 sequence = ACCTGTATAAATAACCAGTT Site: position = -64 score = 5.53257 sequence = ACCTGTATATAACAACAGTA Gene: PM0892: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Mannheimia succiniciproducens MBEL55E Site: position = -66 score = 5.20144 sequence = ATCTGTTTGTTTATACAGTA Site: position = -40 score = 5.73018 sequence = ACCTGTATAAACAAACAGTT Gene: MS0831: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Actinobacillus succinogenes 130Z Site: position = -54 score = 4.40776 sequence = AACTGTAAATTAAATCACAC Site: position = -80 score = 5.11713 sequence = CCCTGTTTAAGAAAACAGTA Gene: Asuc_0946: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Haemophilus somnus 2336 Site: position = -77 score = 5.46669 sequence = ATATGTATATAAAAACAGTA Site: position = -51 score = 5.67493 sequence = ACCTGTATAAATAATCAGTT Gene: HSM_1015: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -61 score = 5.07607 sequence = CACTGTTTTTTTAATCAGTA Site: position = -36 score = 5.53856 sequence = ACCTGTATAAACACACAGTT Site: position = -101 score = 4.88052 sequence = TACTGGATATTTTTACAAAA Gene: APP7_0382: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Haemophilus ducreyi 35000HP Site: position = -61 score = 5.22532 sequence = TACTGTTTTTTTAATCAGTA Site: position = -36 score = 4.77213 sequence = GCCTGTATAAATAACCATAT Site: position = -100 score = 5.15157 sequence = TACTGTATATTTTTACAAAA Gene: HD1063: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	* Haemophilus parasuis SH0165 Site: position = -62 score = 5.30913 sequence = CACTGTGTGTTTAAACAGTA Site: position = -38 score = 5.54121 sequence = AACTGTATAAACACACAGAT Site: position = -102 score = 4.72386 sequence = ACCTGTAAAAATTTACACTA Gene: HAPS_2271: SOS-response transcriptional repressors (RecA-mediated autopeptidases)	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
CRON 10.
ssb	* Haemophilus influenzae Rd KW20 Site: position = -93 score = 5.13851 sequence = ATCTGTGCAAATATCCAGTT Gene: HI0250: Single-stranded DNA-binding protein	* Aggregatibacter aphrophilus NJ8700 Site: position = -110 score = 5.35645 sequence = AACTGTGCAAATATCCAGTT Gene: NT05HA_2209: Single-stranded DNA-binding protein	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -112 score = 5.35645 sequence = AACTGTGCAAATATCCAGTT Gene: PM1950: Single-stranded DNA-binding protein	* Mannheimia succiniciproducens MBEL55E Site: position = -92 score = 5.15819 sequence = AACTGTGAAAATATCCAGTT Gene: MS0585: Single-stranded DNA-binding protein	* Actinobacillus succinogenes 130Z Site: position = -94 score = 4.64688 sequence = ATCTGTTAAAATATTCAGTG Gene: Asuc_1880: Single-stranded DNA-binding protein	*2 Haemophilus somnus 2336 Site: position = -101 score = 5.35645 sequence = AACTGTGCAAATATCCAGTT Gene: HSM_1048: Single-stranded DNA-binding protein Gene: HSM_1745: Single-stranded DNA-binding protein	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -99 score = 5.44826 sequence = AACTGTACAAAATATCAGTT Gene: APP7_0845: Single-stranded DNA-binding protein	* Haemophilus ducreyi 35000HP Site: position = -96 score = 4.92962 sequence = AGCTGTACAAAATATCAGTT Gene: HD1285: Single-stranded DNA-binding protein	* Haemophilus parasuis SH0165 Site: position = -191 score = 5.44826 sequence = AACTGTACAAAATATCAGTT Gene: HAPS_0372: Single-stranded DNA-binding protein	Single-stranded DNA-binding protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD