Regulon of LexA in Aggregatibacter aphrophilus NJ8700

Properties
Regulator type:	Transcription factor
TF locus tag:	NT05HA_1581
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Pasteurellales
Statistics of regulated genes:
- Genes	11
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 96 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Pasteurellales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5.7 Sequence: TACTGTATATAACAACAGTA Position: -37 Score: 5.6 Sequence: CACTGTACAAAAACACAGTT Locus tag: NT05HA_0999 Name: impA Funciton: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
	NT05HA_0999	impA	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
Position: -66 Score: 5.6 Sequence: AACTGGATATTTATCCAGTT Locus tag: NT05HA_1353 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: NT05HA_1352 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	NT05HA_1353	ruvA	Holliday junction DNA helicase RuvA
	NT05HA_1352	ruvB	Holliday junction DNA helicase RuvB
Position: -55 Score: 6.1 Sequence: TACTGTATATTAAAACAGTA Locus tag: NT05HA_1273 Name: recN Funciton: DNA repair protein RecN
	NT05HA_1273	recN	DNA repair protein RecN
Position: -110 Score: 5.4 Sequence: AACTGTGCAAATATCCAGTT Locus tag: NT05HA_2209 Name: ssb Funciton: Single-stranded DNA-binding protein
	NT05HA_2209	ssb	Single-stranded DNA-binding protein
Position: -86 Score: 4.8 Sequence: CACTGTTTTTTTATACAGAC Locus tag: NT05HA_0196 Name: mfd Funciton: Transcription-repair coupling factor (superfamily II helicase)
	NT05HA_0196	mfd	Transcription-repair coupling factor (superfamily II helicase)
Position: -67 Score: 6.1 Sequence: TACTGTATATTAATACAGTT Locus tag: NT05HA_1941 Name: recA Funciton: Recombinase A Locus tag: NT05HA_1940 Name: recX Funciton: Regulatory protein RecX
	NT05HA_1941	recA	Recombinase A
	NT05HA_1940	recX	Regulatory protein RecX
Position: -79 Score: 5.4 Sequence: AACTGGATATTTGCACAGTT Locus tag: NT05HA_2208 Name: uvrA Funciton: Excinuclease ABC subunit A
	NT05HA_2208	uvrA	Excinuclease ABC subunit A
Position: -50 Score: 5.2 Sequence: TTCTGTATATAATACCAGTC Position: -28 Score: 4.9 Sequence: TCATGTATATATTAACAGGA Locus tag: NT05HA_1581 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	NT05HA_1581	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -36 Score: 5.3 Sequence: GCCTGTACAAAAAAACAGTA Locus tag: NT05HA_1086 Name: uvrD Funciton: ATP-dependent DNA helicase II
	NT05HA_1086	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Aggregatibacter aphrophilus NJ8700

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --