Regulon of LexA in Actinobacillus succinogenes 130Z

Properties
Regulator type:	Transcription factor
TF locus tag:	Asuc_0877
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Pasteurellales
Statistics of regulated genes:
- Genes	10
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 96 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Pasteurellales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 5.1 Sequence: CCCTGTTTAAGAAAACAGTA Position: -54 Score: 4.4 Sequence: AACTGTAAATTAAATCACAC Locus tag: Asuc_0946 Name: impA Funciton: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
	Asuc_0946	impA	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
Position: -60 Score: 4.1 Sequence: AGCTGTTGTTTTATTCAGTT Locus tag: Asuc_1800 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: Asuc_1799 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	Asuc_1800	ruvA	Holliday junction DNA helicase RuvA
	Asuc_1799	ruvB	Holliday junction DNA helicase RuvB
Position: -30 Score: 4.8 Sequence: TAGTGTAAATTTAAACAGAT Locus tag: Asuc_1268 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Asuc_1268	uvrD	ATP-dependent DNA helicase II
Position: -34 Score: 4.2 Sequence: TATAATATATTTATACAGTA Locus tag: Asuc_0884 Name: recN Funciton: DNA repair protein RecN
	Asuc_0884	recN	DNA repair protein RecN
Position: -94 Score: 4.6 Sequence: ATCTGTTAAAATATTCAGTG Locus tag: Asuc_1880 Name: ssb Funciton: Single-stranded DNA-binding protein
	Asuc_1880	ssb	Single-stranded DNA-binding protein
Position: -77 Score: 5.1 Sequence: CACTGAATATTTTAACAGAT Locus tag: Asuc_1879 Name: uvrA Funciton: Excinuclease ABC subunit A
	Asuc_1879	uvrA	Excinuclease ABC subunit A
Position: -63 Score: 5.2 Sequence: TACTGTGTTTTATACCAGTT Locus tag: Asuc_0261 Name: recA Funciton: Recombinase A Locus tag: Asuc_0260 Name: recX Funciton: Regulatory protein RecX
	Asuc_0261	recA	Recombinase A
	Asuc_0260	recX	Regulatory protein RecX
Position: -46 Score: 4.4 Sequence: AACTGTATAGAATATCAATC Locus tag: Asuc_0877 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Asuc_0877	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD