Regulon of LexA in Actinobacillus pleuropneumoniae serovar 7 str. AP76

Properties
Regulator type:	Transcription factor
TF locus tag:	APP7_1165
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Pasteurellales
Statistics of regulated genes:
- Genes	9
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 96 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Pasteurellales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.1 Sequence: AACTGTATAAACGAACATTA Locus tag: APP7_1377 Name: uvrD Funciton: ATP-dependent DNA helicase II
	APP7_1377	uvrD	ATP-dependent DNA helicase II
Position: -61 Score: 5.6 Sequence: TACTGTTCAAAAAAACAGTA Locus tag: APP7_0025 Name: recN Funciton: DNA repair protein RecN
	APP7_0025	recN	DNA repair protein RecN
Position: -101 Score: 4.9 Sequence: TACTGGATATTTTTACAAAA Position: -61 Score: 5.1 Sequence: CACTGTTTTTTTAATCAGTA Position: -36 Score: 5.5 Sequence: ACCTGTATAAACACACAGTT Locus tag: APP7_0382 Name: impA Funciton: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
	APP7_0382	impA	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
Position: -99 Score: 5.4 Sequence: AACTGTACAAAATATCAGTT Locus tag: APP7_0845 Name: null Funciton: Single-stranded DNA-binding protein
	APP7_0845		Single-stranded DNA-binding protein
Position: -49 Score: 5.3 Sequence: TACTGTATATAATAACAAAA Position: -28 Score: 5 Sequence: ATCTGTATATAAAGACAGCG Locus tag: APP7_1165 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: APP7_1166 Name: mutH Funciton: DNA mismatch repair endonuclease MutH
	APP7_1165	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	APP7_1166	mutH	DNA mismatch repair endonuclease MutH
Position: 44 Score: 4.9 Sequence: AGCTGTTTATTTACTCAGTA Locus tag: APP7_0940 Name: radA Funciton: DNA repair protein RadA
	APP7_0940	radA	DNA repair protein RadA
Position: -86 Score: 5.3 Sequence: AACTGTATAAGTAAACACTA Locus tag: APP7_1202 Name: recA Funciton: Recombinase A Locus tag: APP7_1201 Name: recX Funciton: Regulatory protein RecX
	APP7_1202	recA	Recombinase A
	APP7_1201	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD