Regulon of LexA in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS0744
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Pasteurellales
Statistics of regulated genes:
- Genes	10
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 96 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Pasteurellales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 5.6 Sequence: AACTGGATATTTTCACAGTT Locus tag: MS0586 Name: uvrA Funciton: Excinuclease ABC subunit A
	MS0586	uvrA	Excinuclease ABC subunit A
Position: -65 Score: 5 Sequence: AACTGGTTATCTATCCAGTT Locus tag: MS0712 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: MS0713 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	MS0712	ruvA	Holliday junction DNA helicase RuvA
	MS0713	ruvB	Holliday junction DNA helicase RuvB
Position: -66 Score: 5.2 Sequence: ATCTGTTTGTTTATACAGTA Position: -40 Score: 5.7 Sequence: ACCTGTATAAACAAACAGTT Locus tag: MS0831 Name: impA Funciton: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
	MS0831	impA	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
Position: -54 Score: 5.5 Sequence: TACTGTATAAAAAAACATAA Locus tag: MS0741 Name: recN Funciton: DNA repair protein RecN
	MS0741	recN	DNA repair protein RecN
Position: -31 Score: 5.1 Sequence: CCCTGTAAAAATAAACAGAT Locus tag: MS1368 Name: uvrD Funciton: ATP-dependent DNA helicase II
	MS1368	uvrD	ATP-dependent DNA helicase II
Position: -92 Score: 5.2 Sequence: AACTGTGAAAATATCCAGTT Locus tag: MS0585 Name: ssb Funciton: Single-stranded DNA-binding protein
	MS0585	ssb	Single-stranded DNA-binding protein
Position: -11 Score: 4.6 Sequence: TCCTGTATATAATGTCAGCA Position: 9 Score: 5.1 Sequence: TTCTGTACAAAAAAACAGGG Locus tag: MS0744 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	MS0744	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -69 Score: 5.8 Sequence: TACTGTATATTATACCAGTT Locus tag: MS2243 Name: recA Funciton: Recombinase A Locus tag: MS2242 Name: recX Funciton: Regulatory protein RecX
	MS2243	recA	Recombinase A
	MS2242	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD