Regulon of LexA in Haemophilus parasuis SH0165

Properties
Regulator type:	Transcription factor
TF locus tag:	HAPS_0014
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Pasteurellales
Statistics of regulated genes:
- Genes	8
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 96 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Pasteurellales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 4.7 Sequence: TACTGTATATAATGTCATAA Position: -28 Score: 5.5 Sequence: TTCTGTATATAAAGACAGTG Locus tag: HAPS_0014 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	HAPS_0014	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -61 Score: 5.7 Sequence: TACTGTGTATAAAAACAGTG Position: -40 Score: 4.6 Sequence: TACTATATACTCATACAGTG Locus tag: HAPS_1355 Name: recN Funciton: DNA repair protein RecN
	HAPS_1355	recN	DNA repair protein RecN
Position: -191 Score: 5.4 Sequence: AACTGTACAAAATATCAGTT Locus tag: HAPS_0372 Name: ssb Funciton: Single-stranded DNA-binding protein
	HAPS_0372	ssb	Single-stranded DNA-binding protein
Position: -30 Score: 4.9 Sequence: CACTGTATAAAATCACATAA Locus tag: HAPS_1067 Name: uvrD Funciton: ATP-dependent DNA helicase II
	HAPS_1067	uvrD	ATP-dependent DNA helicase II
Position: -102 Score: 4.7 Sequence: ACCTGTAAAAATTTACACTA Position: -62 Score: 5.3 Sequence: CACTGTGTGTTTAAACAGTA Position: -38 Score: 5.5 Sequence: AACTGTATAAACACACAGAT Locus tag: HAPS_2271 Name: impA Funciton: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
	HAPS_2271	impA	SOS-response transcriptional repressors (RecA-mediated autopeptidases)
Position: -67 Score: 4.9 Sequence: CCCTGTGCATTTACACAGTG Locus tag: HAPS_2014 Name: radA Funciton: DNA repair protein RadA
	HAPS_2014	radA	DNA repair protein RadA
Position: -84 Score: 5.3 Sequence: AACTGTATGGTTAAACAGTA Locus tag: HAPS_1186 Name: recA Funciton: Recombinase A Locus tag: HAPS_1185 Name: recX Funciton: Regulatory protein RecX
	HAPS_1186	recA	Recombinase A
	HAPS_1185	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD