Regulog AraR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - AraR
- By TF family - GntR/Others
- By effector - Arabinose
- By pathway - Arabinose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 4 | 1 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 5 | 3 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 5 | 2 |
| Lactobacillus reuteri JCM 1112 | 4 | 1 |
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | 3 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 4 | 1 |
| Oenococcus oeni PSU-1 | 1 | 1 |
| Pediococcus pentosaceus ATCC 25745 | 4 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| araA |
|
Gene: LVIS_1740: L-arabinose isomerase (EC 5.3.1.4) |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -105 score = 5.93927 sequence = TGAATTGTACGGACAAATAT Gene: LAF_1554: L-arabinose isomerase (EC 5.3.1.4) |
|
|
Gene: lp_3554: L-arabinose isomerase (EC 5.3.1.4) |
Gene: LAR_0470: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: LSA1856: L-arabinose isomerase (EC 5.3.1.4) |
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -136 score = 5.69916 sequence = TGACTTATACGGACAAATGT Gene: LEUM_0852: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: PEPE_0165: L-arabinose isomerase (EC 5.3.1.4) |
L-arabinose isomerase (EC 5.3.1.4) |
| araE |
|
*
Lactobacillus brevis ATCC 367 Site: position = -212 score = 4.44202 sequence = AAATTAATCCGAATAACAAA Site: position = -183 score = 6.14982 sequence = TGATTTATGCGTACAAATAT Gene: LVIS_1743: L-arabinose-proton symporter |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -153 score = 4.40856 sequence = ATATTGTTCAGTATAATTTA Gene: LAF_1555: L-arabinose-proton symporter |
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -166 score = 6.49899 sequence = TGATTTATACGTATAAATAT Site: position = -195 score = 4.74142 sequence = TAATTTGTGCTGATAAAACA Gene: lp_3557: L-arabinose-proton symporter |
*
Lactobacillus reuteri JCM 1112 Site: position = -103 score = 6.35746 sequence = TGATTTATCCGTACAAATAT Gene: LAR_0467: L-arabinose-proton symporter |
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -250 score = 5.68574 sequence = ATAATTATTCGAATAAATAA Site: position = -150 score = 4.64194 sequence = ATATTGATTCGAATCAAAAA Site: position = -121 score = 4.65112 sequence = TGATTTATTCGAATGAAAGT Gene: LSA1860: L-arabinose-proton symporter |
|
Gene: LEUM_0853: L-arabinose-proton symporter |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -121 score = 4.45335 sequence = AAATTCATCCTAACAAATTT Site: position = -89 score = 6.06911 sequence = TGACTTGTCCGTATAAATAT Gene: PEPE_0162: L-arabinose-proton symporter |
L-arabinose-proton symporter |
| araK |
|
Gene: LVIS_1742: Ribulokinase (EC 2.7.1.16) |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -77 score = 5.93377 sequence = TGATTTATACGGACAAAAAA Gene: LAF_1558: Ribulokinase (EC 2.7.1.16) |
|
|
Gene: lp_3556: Ribulokinase (EC 2.7.1.16) |
Gene: LAR_0468: Ribulokinase (EC 2.7.1.16) |
|
Gene: LSA1859: Ribulokinase (EC 2.7.1.16) |
|
Gene: LEUM_0854: Ribulokinase (EC 2.7.1.16) |
*
Oenococcus oeni PSU-1 Site: position = -149 score = 4.96613 sequence = TGATTTATATGTACGAATGT Site: position = -179 score = 5.02332 sequence = AAATTCATACGTAAAACTAA Site: position = -192 score = 4.53017 sequence = TTATTTTTACAAAAAATTCA Gene: OEOE_0227: Ribulokinase (EC 2.7.1.16) |
Gene: PEPE_0163: Ribulokinase (EC 2.7.1.16) |
Ribulokinase (EC 2.7.1.16) |
| araD |
|
Gene: LVIS_1741: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: LSEI_2731: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: LAF_1557: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
|
Gene: lp_3555: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: LAR_0469: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: LGG_02723: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: LSA1857: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1992: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Gene: LEUM_0855: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: PEPE_0164: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
| araR |
|
Gene: LVIS_1744: Arabinoside utilization transcriptional repressor AraR, GntR family |
|
|
Gene: LAF_1556: Arabinoside utilization transcriptional repressor AraR, GntR family |
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -234 score = 5.16295 sequence = TTATTGATGCGGATAAATTG Gene: lp_3558: Arabinoside utilization transcriptional repressor AraR, GntR family |
Gene: LAR_0473: Arabinoside utilization transcriptional repressor AraR, GntR family |
|
Gene: LSA1861: Arabinoside utilization transcriptional repressor AraR, GntR family |
|
Gene: LEUM_0851: Arabinoside utilization transcriptional repressor AraR, GntR family |
Gene: OEOE_0226: Arabinoside utilization transcriptional repressor AraR, GntR family |
Gene: PEPE_0157: Arabinoside utilization transcriptional repressor AraR, GntR family |
Arabinoside utilization transcriptional repressor AraR, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |