Regulon of AraR in Oenococcus oeni PSU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	OEOE_0226
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Lactobacillaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -192 Score: 4.5 Sequence: TTATTTTTACAAAAAATTCA Position: -179 Score: 5 Sequence: AAATTCATACGTAAAACTAA Position: -149 Score: 5 Sequence: TGATTTATATGTACGAATGT Locus tag: OEOE_0227 Name: araK Funciton: Ribulokinase (EC 2.7.1.16)
	OEOE_0227	araK	Ribulokinase (EC 2.7.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD