Regulon of AraR in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_3558
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -195 Score: 4.7 Sequence: TAATTTGTGCTGATAAAACA Position: -166 Score: 6.5 Sequence: TGATTTATACGTATAAATAT Locus tag: lp_3557 Name: araE Funciton: L-arabinose-proton symporter Locus tag: lp_3556 Name: araK Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: lp_3555 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: lp_3554 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
	lp_3557	araE	L-arabinose-proton symporter
	lp_3556	araK	Ribulokinase (EC 2.7.1.16)
	lp_3555	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	lp_3554	araA	L-arabinose isomerase (EC 5.3.1.4)
Position: -234 Score: 5.2 Sequence: TTATTGATGCGGATAAATTG Locus tag: lp_3558 Name: araR Funciton: Arabinoside utilization transcriptional repressor AraR, GntR family
	lp_3558	araR	Arabinoside utilization transcriptional repressor AraR, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD