Regulon of AraR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA1861
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -250 Score: 5.7 Sequence: ATAATTATTCGAATAAATAA Position: -150 Score: 4.6 Sequence: ATATTGATTCGAATCAAAAA Position: -121 Score: 4.7 Sequence: TGATTTATTCGAATGAAAGT Locus tag: LSA1860 Name: araE Funciton: L-arabinose-proton symporter Locus tag: LSA1859 Name: araK Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: LSA1857 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	LSA1860	araE	L-arabinose-proton symporter
	LSA1859	araK	Ribulokinase (EC 2.7.1.16)
	LSA1857	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD