Regulog ModE - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Haemophilus influenzae Rd KW20	10	5
Aggregatibacter aphrophilus NJ8700	12	4
Pasteurella multocida subsp. multocida str. Pm70	12	4
Mannheimia succiniciproducens MBEL55E	6	3
Actinobacillus succinogenes 130Z	6	3
Haemophilus somnus 2336
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
moaA	* Haemophilus influenzae Rd KW20 Site: position = -246 score = 6.84986 sequence = TTCATTATGTATTTTTTTATATAATTGA Gene: HI1676: Molybdenum cofactor biosynthesis protein A	* Aggregatibacter aphrophilus NJ8700 Site: position = -252 score = 6.88631 sequence = ATCGCTATATAAATTTATATATAATTGA Gene: NT05HA_0848: Molybdenum cofactor biosynthesis protein A	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -266 score = 6.66102 sequence = AACGCTATATATTTTGTTATATAATTGA Gene: PM0625: Molybdenum cofactor biosynthesis protein A	* Mannheimia succiniciproducens MBEL55E Site: position = -254 score = 6.18268 sequence = TCTGTTATATACATTTATATATAACTGA Gene: MS1021: Molybdenum cofactor biosynthesis protein A	* Actinobacillus succinogenes 130Z Site: position = -258 score = 6.56398 sequence = TTCGCTATAAAATTAAATATATAATTGA Gene: Asuc_1677: Molybdenum cofactor biosynthesis protein A	Haemophilus somnus 2336 Gene: HSM_1509: Molybdenum cofactor biosynthesis protein A	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0732: Molybdenum cofactor biosynthesis protein A	Haemophilus ducreyi 35000HP Gene: HD1392: Molybdenum cofactor biosynthesis protein A	Haemophilus parasuis SH0165 Gene: HAPS_0436: Molybdenum cofactor biosynthesis protein A	Molybdenum cofactor biosynthesis protein A
moaC	Haemophilus influenzae Rd KW20 Gene: HI1675: Molybdenum cofactor biosynthesis protein C	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0847: Molybdenum cofactor biosynthesis protein C	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0624: Molybdenum cofactor biosynthesis protein C	Mannheimia succiniciproducens MBEL55E Gene: MS1022: Molybdenum cofactor biosynthesis protein C	Actinobacillus succinogenes 130Z Gene: Asuc_1676: Molybdenum cofactor biosynthesis protein C	Haemophilus somnus 2336 Gene: HSM_1508: Molybdenum cofactor biosynthesis protein C	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0733: Molybdenum cofactor biosynthesis protein C	Haemophilus ducreyi 35000HP Gene: HD1391: Molybdenum cofactor biosynthesis protein C	Haemophilus parasuis SH0165 Gene: HAPS_0437: Molybdenum cofactor biosynthesis protein C	Molybdenum cofactor biosynthesis protein C
moaD	Haemophilus influenzae Rd KW20 Gene: HI1674: Molybdopterin synthase sulfur carrier subunit	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0846: Molybdopterin synthase sulfur carrier subunit	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0623: Molybdopterin synthase sulfur carrier subunit	Mannheimia succiniciproducens MBEL55E Gene: MS1023: Molybdopterin synthase sulfur carrier subunit	Actinobacillus succinogenes 130Z Gene: Asuc_1675: Molybdopterin synthase sulfur carrier subunit	Haemophilus somnus 2336 Gene: HSM_1507: Molybdopterin synthase sulfur carrier subunit	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0734: Molybdopterin synthase sulfur carrier subunit	Haemophilus ducreyi 35000HP Gene: HD1390: Molybdopterin synthase sulfur carrier subunit	Haemophilus parasuis SH0165 Gene: HAPS_0438: Molybdopterin synthase sulfur carrier subunit	Molybdopterin synthase sulfur carrier subunit
moaE	Haemophilus influenzae Rd KW20 Gene: HI1673: Molybdopterin synthase catalytic subunit	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0845: Molybdopterin synthase catalytic subunit	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0622: Molybdopterin synthase catalytic subunit	Mannheimia succiniciproducens MBEL55E Gene: MS1024: Molybdopterin synthase catalytic subunit	Actinobacillus succinogenes 130Z Gene: Asuc_1674: Molybdopterin synthase catalytic subunit	Haemophilus somnus 2336 Gene: HSM_1506: Molybdopterin synthase catalytic subunit	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0735: Molybdopterin synthase catalytic subunit	Haemophilus ducreyi 35000HP Gene: HD1389: Molybdopterin synthase catalytic subunit	Haemophilus parasuis SH0165 Gene: HAPS_0439: Molybdopterin synthase catalytic subunit	Molybdopterin synthase catalytic subunit

CRON 2.
modA	* Haemophilus influenzae Rd KW20 Site: position = -101 score = 6.17428 sequence = AGCGTTATATATTTTACTAAATAATTTT Gene: HI1693: Molybdate ABC transporter, substrate-binding protein	* Aggregatibacter aphrophilus NJ8700 Site: position = -58 score = 6.03474 sequence = TTCGTTGTATAATTTGTGCTATATATAA Gene: NT05HA_1098: Molybdate ABC transporter, substrate-binding protein	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -69 score = 6.73127 sequence = AACATTGTATAATTTTTTATATAAAGTT Gene: PM0744: Molybdate ABC transporter, substrate-binding protein	* Mannheimia succiniciproducens MBEL55E Site: position = -46 score = 6.35712 sequence = TTCATTATATAATTGGATAAATAGCGAA Gene: MS1342: Molybdate ABC transporter, substrate-binding protein	* Actinobacillus succinogenes 130Z Site: position = -63 score = 5.956 sequence = TAAGTTATATAATTTATTACATATATCT Gene: Asuc_1559: Molybdate ABC transporter, substrate-binding protein	Haemophilus somnus 2336 Gene: HSM_0342: Molybdate ABC transporter, substrate-binding protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0264: Molybdate ABC transporter, substrate-binding protein	Haemophilus ducreyi 35000HP Gene: HD1823: Molybdate ABC transporter, substrate-binding protein	* Haemophilus parasuis SH0165 Site: position = -152 score = 6.62152 sequence = TTCGTTATATAATAGTTTATATATTGTT Gene: HAPS_1456: Molybdate ABC transporter, substrate-binding protein	Molybdate ABC transporter, substrate-binding protein
modB	Haemophilus influenzae Rd KW20 Gene: HI1692: Molybdate ABC transporter, permease protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1097: Molybdate ABC transporter, permease protein	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0743: Molybdate ABC transporter, permease protein	Mannheimia succiniciproducens MBEL55E Gene: MS1341: Molybdate ABC transporter, permease protein	Actinobacillus succinogenes 130Z Gene: Asuc_0180: Molybdate ABC transporter, permease protein	Haemophilus somnus 2336 Gene: HSM_0343: Molybdate ABC transporter, permease protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0263: Molybdate ABC transporter, permease protein	Haemophilus ducreyi 35000HP Gene: HD1824: Molybdate ABC transporter, permease protein	Haemophilus parasuis SH0165 Gene: HAPS_0813: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Haemophilus influenzae Rd KW20 Gene: HI1691: Molybdate ABC transporter, ATP-binding protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1096: Molybdate ABC transporter, ATP-binding protein	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0742: Molybdate ABC transporter, ATP-binding protein	Mannheimia succiniciproducens MBEL55E Gene: MS1340: Molybdate ABC transporter, ATP-binding protein	Actinobacillus succinogenes 130Z Gene: Asuc_0181: Molybdate ABC transporter, ATP-binding protein	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0262: Molybdate ABC transporter, ATP-binding protein	Haemophilus ducreyi 35000HP Gene: HD1826: Molybdate ABC transporter, ATP-binding protein	Haemophilus parasuis SH0165 Gene: HAPS_0814: Molybdate ABC transporter, ATP-binding protein	Molybdate ABC transporter, ATP-binding protein

CRON 3.
momA	* Haemophilus influenzae Rd KW20 Site: position = -60 score = 6.75013 sequence = TTCATTATACAATTTTATATATATCGAT Gene: HI1525: Predicted ABC transporter, substrate-binding protein	* Aggregatibacter aphrophilus NJ8700 Site: position = -68 score = 6.53788 sequence = TTCATTATATTTATTTTTATATAACCAA Gene: NT05HA_0272: Predicted ABC transporter, substrate-binding protein	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -68 score = 6.2946 sequence = TTCGATATATTACATTTTATATAATGAT Gene: PM1108: Predicted ABC transporter, substrate-binding protein	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Predicted ABC transporter, substrate-binding protein
momB	Haemophilus influenzae Rd KW20 Gene: HI1475: Predicted ABC transporter, permease protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0273: Predicted ABC transporter, permease protein	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1109: Predicted ABC transporter, permease protein	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Predicted ABC transporter, permease protein
momC	Haemophilus influenzae Rd KW20 Gene: HI1474: Predicted ABC transporter, ATP-binding protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0274: Predicted ABC transporter, ATP-binding protein	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1110: Predicted ABC transporter, ATP-binding protein	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Predicted ABC transporter, ATP-binding protein
momD	Haemophilus influenzae Rd KW20 Gene: HI1473: Predicted pyrophosphorylase	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0275: Predicted pyrophosphorylase	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1111: Predicted pyrophosphorylase	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Predicted pyrophosphorylase

CRON 4.
ybgI	* Haemophilus influenzae Rd KW20 Site: position = -161 score = 6.46227 sequence = ATCGCTATAAATTTATGTATATAATGAA Gene: HI0105: Conserved metal-binding protein	* Aggregatibacter aphrophilus NJ8700 Site: position = -191 score = 6.40414 sequence = ATCGTTATATATTAAATTGTATAATGAA Gene: NT05HA_0380: Conserved metal-binding protein	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -190 score = 5.87404 sequence = ACCATTATATAATAAAGTATATAATGAG Gene: PM0183: Conserved metal-binding protein	Mannheimia succiniciproducens MBEL55E Gene: MS1464: Conserved metal-binding protein	Actinobacillus succinogenes 130Z Gene: Asuc_1068: Conserved metal-binding protein	Haemophilus somnus 2336 Gene: HSM_1003: Conserved metal-binding protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0671: Conserved metal-binding protein	Haemophilus ducreyi 35000HP Gene: HD1471: Conserved metal-binding protein	Haemophilus parasuis SH0165 Gene: HAPS_0502: Conserved metal-binding protein	Conserved metal-binding protein

CRON 5.
modE	* Haemophilus influenzae Rd KW20 Site: position = -118 score = 5.87285 sequence = AACGTTATTTACTTGATTATATATTGAA Gene: HI1694: Molybdate-responsive transcriptional regulator ModE	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1099: Molybdate-responsive transcriptional regulator ModE	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0746: Molybdate-responsive transcriptional regulator ModE	* Mannheimia succiniciproducens MBEL55E Site: position = -107 score = 5.48679 sequence = TTCGCTATTTATCCAATTATATAATGAA Gene: MS1344: Molybdate-responsive transcriptional regulator ModE	* Actinobacillus succinogenes 130Z Site: position = -118 score = 6.03819 sequence = TGCGTTATATAATTTAAGATATATGTAA Gene: Asuc_1560: Molybdate-responsive transcriptional regulator ModE	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	* Haemophilus parasuis SH0165 Site: position = -119 score = 6.12387 sequence = AACAATATATAAACTATTATATAACGAA Gene: HAPS_1455: Molybdate-responsive transcriptional regulator ModE	Molybdate-responsive transcriptional regulator ModE

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --