Regulon of ModE in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS1344
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pasteurellales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -254 Score: 6.2 Sequence: TCTGTTATATACATTTATATATAACTGA Locus tag: MS1021 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein A Locus tag: MS1022 Name: moaC Funciton: Molybdenum cofactor biosynthesis protein C Locus tag: MS1023 Name: moaD Funciton: Molybdopterin synthase sulfur carrier subunit Locus tag: MS1024 Name: moaE Funciton: Molybdopterin synthase catalytic subunit
	MS1021	moaA	Molybdenum cofactor biosynthesis protein A
	MS1022	moaC	Molybdenum cofactor biosynthesis protein C
	MS1023	moaD	Molybdopterin synthase sulfur carrier subunit
	MS1024	moaE	Molybdopterin synthase catalytic subunit
Position: -107 Score: 5.5 Sequence: TTCGCTATTTATCCAATTATATAATGAA Locus tag: MS1344 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	MS1344	modE	Molybdate-responsive transcriptional regulator ModE
Position: -46 Score: 6.4 Sequence: TTCATTATATAATTGGATAAATAGCGAA Locus tag: MS1342 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
	MS1342	modA	Molybdate ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD