Regulon of ModE in Haemophilus parasuis SH0165

Properties
Regulator type:	Transcription factor
TF locus tag:	HAPS_1455
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pasteurellales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.1 Sequence: AACAATATATAAACTATTATATAACGAA Locus tag: HAPS_1455 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	HAPS_1455	modE	Molybdate-responsive transcriptional regulator ModE
Position: -152 Score: 6.6 Sequence: TTCGTTATATAATAGTTTATATATTGTT Locus tag: HAPS_1456 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
	HAPS_1456	modA	Molybdate ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD