Regulon of ModE in Haemophilus influenzae Rd KW20

Properties
Regulator type:	Transcription factor
TF locus tag:	HI1694
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pasteurellales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 6.5 Sequence: ATCGCTATAAATTTATGTATATAATGAA Locus tag: HI0105 Name: ybgI Funciton: Conserved metal-binding protein
	HI0105	ybgI	Conserved metal-binding protein
Position: -246 Score: 6.8 Sequence: TTCATTATGTATTTTTTTATATAATTGA Locus tag: HI1676 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein A Locus tag: HI1675 Name: moaC Funciton: Molybdenum cofactor biosynthesis protein C Locus tag: HI1674 Name: moaD Funciton: Molybdopterin synthase sulfur carrier subunit Locus tag: HI1673 Name: moaE Funciton: Molybdopterin synthase catalytic subunit
	HI1676	moaA	Molybdenum cofactor biosynthesis protein A
	HI1675	moaC	Molybdenum cofactor biosynthesis protein C
	HI1674	moaD	Molybdopterin synthase sulfur carrier subunit
	HI1673	moaE	Molybdopterin synthase catalytic subunit
Position: -60 Score: 6.8 Sequence: TTCATTATACAATTTTATATATATCGAT Locus tag: HI1525 Name: momA Funciton: Predicted ABC transporter, substrate-binding protein
	HI1525	momA	Predicted ABC transporter, substrate-binding protein
Position: -101 Score: 6.2 Sequence: AGCGTTATATATTTTACTAAATAATTTT Locus tag: HI1693 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: HI1692 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: HI1691 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	HI1693	modA	Molybdate ABC transporter, substrate-binding protein
	HI1692	modB	Molybdate ABC transporter, permease protein
	HI1691	modC	Molybdate ABC transporter, ATP-binding protein
Position: -118 Score: 5.9 Sequence: AACGTTATTTACTTGATTATATATTGAA Locus tag: HI1694 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	HI1694	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD