Regulon of ModE in Actinobacillus succinogenes 130Z

Properties
Regulator type:	Transcription factor
TF locus tag:	Asuc_1560
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pasteurellales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6 Sequence: TAAGTTATATAATTTATTACATATATCT Locus tag: Asuc_1559 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
	Asuc_1559	modA	Molybdate ABC transporter, substrate-binding protein
Position: -258 Score: 6.6 Sequence: TTCGCTATAAAATTAAATATATAATTGA Locus tag: Asuc_1677 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein A Locus tag: Asuc_1676 Name: moaC Funciton: Molybdenum cofactor biosynthesis protein C Locus tag: Asuc_1675 Name: moaD Funciton: Molybdopterin synthase sulfur carrier subunit Locus tag: Asuc_1674 Name: moaE Funciton: Molybdopterin synthase catalytic subunit
	Asuc_1677	moaA	Molybdenum cofactor biosynthesis protein A
	Asuc_1676	moaC	Molybdenum cofactor biosynthesis protein C
	Asuc_1675	moaD	Molybdopterin synthase sulfur carrier subunit
	Asuc_1674	moaE	Molybdopterin synthase catalytic subunit
Position: -118 Score: 6 Sequence: TGCGTTATATAATTTAAGATATATGTAA Locus tag: Asuc_1560 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Asuc_1560	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD