Regulon of ModE in Pasteurella multocida subsp. multocida str. Pm70

Properties
Regulator type:	Transcription factor
TF locus tag:	PM0746
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pasteurellales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pasteurellales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 5.9 Sequence: ACCATTATATAATAAAGTATATAATGAG Locus tag: PM0183 Name: ybgI Funciton: Conserved metal-binding protein
	PM0183	ybgI	Conserved metal-binding protein
Position: -266 Score: 6.7 Sequence: AACGCTATATATTTTGTTATATAATTGA Locus tag: PM0625 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein A Locus tag: PM0624 Name: moaC Funciton: Molybdenum cofactor biosynthesis protein C Locus tag: PM0623 Name: moaD Funciton: Molybdopterin synthase sulfur carrier subunit Locus tag: PM0622 Name: moaE Funciton: Molybdopterin synthase catalytic subunit
	PM0625	moaA	Molybdenum cofactor biosynthesis protein A
	PM0624	moaC	Molybdenum cofactor biosynthesis protein C
	PM0623	moaD	Molybdopterin synthase sulfur carrier subunit
	PM0622	moaE	Molybdopterin synthase catalytic subunit
Position: -68 Score: 6.3 Sequence: TTCGATATATTACATTTTATATAATGAT Locus tag: PM1108 Name: momA Funciton: Predicted ABC transporter, substrate-binding protein Locus tag: PM1109 Name: momB Funciton: Predicted ABC transporter, permease protein Locus tag: PM1110 Name: momC Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: PM1111 Name: momD Funciton: Predicted pyrophosphorylase
	PM1108	momA	Predicted ABC transporter, substrate-binding protein
	PM1109	momB	Predicted ABC transporter, permease protein
	PM1110	momC	Predicted ABC transporter, ATP-binding protein
	PM1111	momD	Predicted pyrophosphorylase
Position: -69 Score: 6.7 Sequence: AACATTGTATAATTTTTTATATAAAGTT Locus tag: PM0744 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: PM0743 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: PM0742 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	PM0744	modA	Molybdate ABC transporter, substrate-binding protein
	PM0743	modB	Molybdate ABC transporter, permease protein
	PM0742	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD