Regulog Irr - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Irr
- By taxonomy - Rhodospirillales
- By TF family - FUR
- By effector - Heme
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | 3 | 2 |
| Magnetospirillum magnetotacticum MS-1 | 4 | 4 |
| Magnetospirillum magneticum AMB-1 | 1 | 1 |
| Azospirillum sp. B510 | 1 | 1 |
| Rhodospirillum centenum SW | 4 | 4 |
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| sufS2 |
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -205 score = 5.04377 sequence = CTCTTAGAATAATTCTAGACG Site: position = -186 score = 6.06644 sequence = CGATTAGAACTATTCTAAACT Gene: Magn03001119: Cysteine desulfurase (EC 2.8.1.7) |
|
|
|
|
|
|
|
Cysteine desulfurase (EC 2.8.1.7) |
| CRON 2. | ||||||||||
| ccpA |
*
Rhodospirillum rubrum ATCC 11170 Site: position = -96 score = 4.27796 sequence = TTCCTAGAGCAATTCCAATAT Gene: Rru_A1789: Cytochrome c551 peroxidase (EC 1.11.1.5) |
|
*
Magnetospirillum magneticum AMB-1 Site: position = -164 score = 5.06972 sequence = GAGTTAGAAGAATTCTAAATA Gene: amb2822: Cytochrome c551 peroxidase (EC 1.11.1.5) |
*
Azospirillum sp. B510 Site: position = -173 score = 6.00017 sequence = AGTTTAGAATAATTCCAGATT Gene: AZL_001890: Cytochrome c551 peroxidase (EC 1.11.1.5) |
*
Rhodospirillum centenum SW Site: position = -77 score = 4.57791 sequence = TCTTTAGATTTATTCAAGATC Gene: RC1_3828: Cytochrome c551 peroxidase (EC 1.11.1.5) |
|
|
|
|
Cytochrome c551 peroxidase (EC 1.11.1.5) |
| CRON 3. | ||||||||||
| dps |
Gene: Rru_A0333: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
|
Gene: AZL_002060: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
*2
Rhodospirillum centenum SW Site: position = -63 score = 5.71345 sequence = AACTTGGAAGAATTCTAAACT Gene: RC1_1876: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Gene: RC1_1875: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
|
|
|
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
| CRON 4. | ||||||||||
| fhuA |
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -180 score = 4.92125 sequence = AAATAAGAATAATTCTATACA Gene: Magn03006487: Ferrichrome-iron outer membrane receptor |
|
|
|
|
|
|
|
Ferrichrome-iron outer membrane receptor |
| CRON 5. | ||||||||||
| irr |
Gene: Rru_A3788: Iron-responsive regulator Irr |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -61 score = 4.10496 sequence = TTTTTCGAACGACTCCATGTT Gene: Magn03009205: Iron-responsive regulator Irr |
Gene: amb4306: Iron-responsive regulator Irr |
Gene: AZL_026170: Iron-responsive regulator Irr |
*
Rhodospirillum centenum SW Site: position = -104 score = 4.65784 sequence = GGCCTTGAATTGTTCCAAATA Gene: RC1_2944: Iron-responsive regulator Irr |
|
|
|
|
Iron-responsive regulator Irr |
| CRON 6. | ||||||||||
| bfd |
*
Rhodospirillum rubrum ATCC 11170 Site: position = -43 score = 4.80991 sequence = GGTTTTGAGTGGTTTTAATCT Gene: Rru_A2196: bacterioferritin-associated ferredoxin |
Gene: Magn03008031: bacterioferritin-associated ferredoxin |
|
Gene: AZL_011850: bacterioferritin-associated ferredoxin |
Gene: RC1_3427: bacterioferritin-associated ferredoxin |
Gene: Gdia_2924: bacterioferritin-associated ferredoxin |
Gene: APA01_04500: bacterioferritin-associated ferredoxin |
|
|
bacterioferritin-associated ferredoxin |
| bfr |
Gene: Rru_A2195: Bacterioferritin (cytochrome b1) |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -156 score = 5.59555 sequence = AGTTTGGGATCATTCCAAACT Gene: Magn03005274: Bacterioferritin (cytochrome b1) |
|
|
*
Rhodospirillum centenum SW Site: position = -48 score = 4.44337 sequence = GTTTTAAACTCGTTCCAGACT Gene: RC1_3428: Bacterioferritin (cytochrome b1) |
|
|
|
|
Bacterioferritin (cytochrome b1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |