Regulon of Irr in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03009205, Magn03006791
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodospirillales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -180 Score: 4.9 Sequence: AAATAAGAATAATTCTATACA Locus tag: Magn03006487 Name: fhuA Funciton: Ferrichrome-iron outer membrane receptor
	Magn03006487	fhuA	Ferrichrome-iron outer membrane receptor
Position: -156 Score: 5.6 Sequence: AGTTTGGGATCATTCCAAACT Locus tag: Magn03005274 Name: bfr Funciton: Bacterioferritin (cytochrome b1)
	Magn03005274	bfr	Bacterioferritin (cytochrome b1)
Position: -205 Score: 5 Sequence: CTCTTAGAATAATTCTAGACG Position: -186 Score: 6.1 Sequence: CGATTAGAACTATTCTAAACT Locus tag: Magn03001119 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7)
	Magn03001119	sufS2	Cysteine desulfurase (EC 2.8.1.7)
Position: -61 Score: 4.1 Sequence: TTTTTCGAACGACTCCATGTT Locus tag: Magn03009205 Name: irr Funciton: Iron-responsive regulator Irr
	Magn03009205	irr	Iron-responsive regulator Irr

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD