Regulon of Irr in Rhodospirillum centenum SW

Properties
Regulator type:	Transcription factor
TF locus tag:	RC1_2944
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodospirillales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 4.7 Sequence: GGCCTTGAATTGTTCCAAATA Locus tag: RC1_2944 Name: irr Funciton: Iron-responsive regulator Irr
	RC1_2944	irr	Iron-responsive regulator Irr
Position: -48 Score: 4.4 Sequence: GTTTTAAACTCGTTCCAGACT Locus tag: RC1_3428 Name: bfr Funciton: Bacterioferritin (cytochrome b1)
	RC1_3428	bfr	Bacterioferritin (cytochrome b1)
Position: -63 Score: 5.7 Sequence: AACTTGGAAGAATTCTAAACT Locus tag: RC1_1876 Name: dps1 Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	RC1_1876	dps1	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Position: -77 Score: 4.6 Sequence: TCTTTAGATTTATTCAAGATC Locus tag: RC1_3828 Name: ccpA Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	RC1_3828	ccpA	Cytochrome c551 peroxidase (EC 1.11.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD