Regulon of Irr in Magnetospirillum magneticum AMB-1

Properties
Regulator type:	Transcription factor
TF locus tag:	amb4306, amb1662
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodospirillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodospirillales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 5.1 Sequence: GAGTTAGAAGAATTCTAAATA Locus tag: amb2822 Name: ccpA Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	amb2822	ccpA	Cytochrome c551 peroxidase (EC 1.11.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD