Regulon of Irr in Rhodospirillum rubrum ATCC 11170

Properties
Regulator type:	Transcription factor
TF locus tag:	Rru_A3788
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodospirillales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 4.8 Sequence: GGTTTTGAGTGGTTTTAATCT Locus tag: Rru_A2196 Name: bfd Funciton: bacterioferritin-associated ferredoxin Locus tag: Rru_A2195 Name: bfr Funciton: Bacterioferritin (cytochrome b1)
	Rru_A2196	bfd	bacterioferritin-associated ferredoxin
	Rru_A2195	bfr	Bacterioferritin (cytochrome b1)
Position: -96 Score: 4.3 Sequence: TTCCTAGAGCAATTCCAATAT Locus tag: Rru_A1789 Name: ccpA Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	Rru_A1789	ccpA	Cytochrome c551 peroxidase (EC 1.11.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD