Regulog IscR - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Rhodospirillum rubrum ATCC 11170	4	1
Magnetospirillum magnetotacticum MS-1	1	1
Magnetospirillum magneticum AMB-1	10	1
Azospirillum sp. B510	5	1
Rhodospirillum centenum SW	4	1
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
cysE	* Rhodospirillum rubrum ATCC 11170 Site: position = -116 score = 6.96087 sequence = ATTCTTGACCGATTTTCTCGGACAC Gene: Rru_A2029: Serine acetyltransferase (EC 2.3.1.30)	* Magnetospirillum magnetotacticum MS-1 Site: position = -193 score = 7.17465 sequence = AATCTTGACTGGCCTTGTCGGGCAT Gene: Magn03007535: Serine acetyltransferase (EC 2.3.1.30)	* Magnetospirillum magneticum AMB-1 Site: position = -117 score = 7.27612 sequence = AATCTTGACTGGCCTTGTCGGACAT Gene: amb3031: Serine acetyltransferase (EC 2.3.1.30)	2 Azospirillum sp. B510* Gene: AZL_006530: Serine acetyltransferase (EC 2.3.1.30) Site: position = -200 score = 7.04525 sequence = ATTCTTGACCGTTTTGCTTGGTCAT Gene: AZL_020070: Serine acetyltransferase (EC 2.3.1.30)	* Rhodospirillum centenum SW Site: position = -129 score = 6.64562 sequence = ATACTTGACCATACTGGTAGGTCAT Gene: RC1_1619: Serine acetyltransferase (EC 2.3.1.30)	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Serine acetyltransferase (EC 2.3.1.30)
iscR	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A2028: Iron-sulfur cluster regulator IscR	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007504: Iron-sulfur cluster regulator IscR	Magnetospirillum magneticum AMB-1 Gene: amb3030: Iron-sulfur cluster regulator IscR	Azospirillum sp. B510 Gene: AZL_020080: Iron-sulfur cluster regulator IscR	Rhodospirillum centenum SW Gene: RC1_1618: Iron-sulfur cluster regulator IscR	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Iron-sulfur cluster regulator IscR
iscS2	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A2027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	2 Magnetospirillum magnetotacticum MS-1 Gene: Magn03007506: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Gene: Magn03007505: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Magnetospirillum magneticum AMB-1 Gene: amb3029: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Azospirillum sp. B510 Gene: AZL_020090: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Rhodospirillum centenum SW Gene: RC1_1616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Gluconacetobacter diazotrophicus PAl 5 Gene: Gdia_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Acetobacter pasteurianus IFO 3283-01 Gene: APA01_26020: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Gluconobacter oxydans 621H Gene: GOX1368: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Granulibacter bethesdensis CGDNIH1 Gene: GbCGDNIH1_1944: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscS	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007507: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Magnetospirillum magneticum AMB-1 Gene: amb3028: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5 Gene: Gdia_0616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Acetobacter pasteurianus IFO 3283-01 Gene: APA01_26010: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Gluconobacter oxydans 621H Gene: GOX1369: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Granulibacter bethesdensis CGDNIH1 Gene: GbCGDNIH1_1943: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007508: Iron-sulfur cluster assembly scaffold protein IscU	Magnetospirillum magneticum AMB-1 Gene: amb3027: Iron-sulfur cluster assembly scaffold protein IscU	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007509: Iron binding protein IscA for iron-sulfur cluster assembly	Magnetospirillum magneticum AMB-1 Gene: amb3026: Iron binding protein IscA for iron-sulfur cluster assembly	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007510: Chaperone protein HscB	Magnetospirillum magneticum AMB-1 Gene: amb3025: Chaperone protein HscB	Azospirillum sp. B510 Gene: AZL_020100: Chaperone protein HscB	Rhodospirillum centenum SW Gene: RC1_1615: Chaperone protein HscB	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Chaperone protein HscB
hscA	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007511: Chaperone protein HscA	Magnetospirillum magneticum AMB-1 Gene: amb3024: Chaperone protein HscA	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Chaperone protein HscA
fdx	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A2026: ferredoxin, 2Fe-2S type, ISC system	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007592: ferredoxin, 2Fe-2S type, ISC system	Magnetospirillum magneticum AMB-1 Gene: amb3023: ferredoxin, 2Fe-2S type, ISC system	Azospirillum sp. B510 Gene: AZL_020110: ferredoxin, 2Fe-2S type, ISC system	Rhodospirillum centenum SW Gene: RC1_1614: ferredoxin, 2Fe-2S type, ISC system	Gluconacetobacter diazotrophicus PAl 5 Gene: Gdia_0615: ferredoxin, 2Fe-2S type, ISC system	Acetobacter pasteurianus IFO 3283-01 Gene: APA01_26000: ferredoxin, 2Fe-2S type, ISC system	Gluconobacter oxydans 621H Gene: GOX1370: ferredoxin, 2Fe-2S type, ISC system	Granulibacter bethesdensis CGDNIH1 Gene: GbCGDNIH1_1942: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03007591: putative Fe-S cluster assembly protein	Magnetospirillum magneticum AMB-1 Gene: amb3022: putative Fe-S cluster assembly protein	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	putative Fe-S cluster assembly protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Rhodospirillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --