Regulog IscR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | 4 | 1 |
| Magnetospirillum magnetotacticum MS-1 | 1 | 1 |
| Magnetospirillum magneticum AMB-1 | 10 | 1 |
| Azospirillum sp. B510 | 5 | 1 |
| Rhodospirillum centenum SW | 4 | 1 |
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| cysE |
*
Rhodospirillum rubrum ATCC 11170 Site: position = -116 score = 6.96087 sequence = ATTCTTGACCGATTTTCTCGGACAC Gene: Rru_A2029: Serine acetyltransferase (EC 2.3.1.30) |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -193 score = 7.17465 sequence = AATCTTGACTGGCCTTGTCGGGCAT Gene: Magn03007535: Serine acetyltransferase (EC 2.3.1.30) |
*
Magnetospirillum magneticum AMB-1 Site: position = -117 score = 7.27612 sequence = AATCTTGACTGGCCTTGTCGGACAT Gene: amb3031: Serine acetyltransferase (EC 2.3.1.30) |
*2
Azospirillum sp. B510 Gene: AZL_006530: Serine acetyltransferase (EC 2.3.1.30) Site: position = -200 score = 7.04525 sequence = ATTCTTGACCGTTTTGCTTGGTCAT Gene: AZL_020070: Serine acetyltransferase (EC 2.3.1.30) |
*
Rhodospirillum centenum SW Site: position = -129 score = 6.64562 sequence = ATACTTGACCATACTGGTAGGTCAT Gene: RC1_1619: Serine acetyltransferase (EC 2.3.1.30) |
|
|
|
|
Serine acetyltransferase (EC 2.3.1.30) |
| iscR |
Gene: Rru_A2028: Iron-sulfur cluster regulator IscR |
Gene: Magn03007504: Iron-sulfur cluster regulator IscR |
Gene: amb3030: Iron-sulfur cluster regulator IscR |
Gene: AZL_020080: Iron-sulfur cluster regulator IscR |
Gene: RC1_1618: Iron-sulfur cluster regulator IscR |
|
|
|
|
Iron-sulfur cluster regulator IscR |
| iscS2 |
Gene: Rru_A2027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
2
Magnetospirillum magnetotacticum MS-1 Gene: Magn03007506: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Gene: Magn03007505: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: amb3029: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: AZL_020090: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: RC1_1616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Gdia_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: APA01_26020: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: GOX1368: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: GbCGDNIH1_1944: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscS |
|
Gene: Magn03007507: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: amb3028: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
|
|
Gene: Gdia_0616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: APA01_26010: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: GOX1369: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: GbCGDNIH1_1943: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
|
Gene: Magn03007508: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: amb3027: Iron-sulfur cluster assembly scaffold protein IscU |
|
|
|
|
|
|
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
|
Gene: Magn03007509: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: amb3026: Iron binding protein IscA for iron-sulfur cluster assembly |
|
|
|
|
|
|
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
|
Gene: Magn03007510: Chaperone protein HscB |
Gene: amb3025: Chaperone protein HscB |
Gene: AZL_020100: Chaperone protein HscB |
Gene: RC1_1615: Chaperone protein HscB |
|
|
|
|
Chaperone protein HscB |
| hscA |
|
Gene: Magn03007511: Chaperone protein HscA |
Gene: amb3024: Chaperone protein HscA |
|
|
|
|
|
|
Chaperone protein HscA |
| fdx |
Gene: Rru_A2026: ferredoxin, 2Fe-2S type, ISC system |
Gene: Magn03007592: ferredoxin, 2Fe-2S type, ISC system |
Gene: amb3023: ferredoxin, 2Fe-2S type, ISC system |
Gene: AZL_020110: ferredoxin, 2Fe-2S type, ISC system |
Gene: RC1_1614: ferredoxin, 2Fe-2S type, ISC system |
Gene: Gdia_0615: ferredoxin, 2Fe-2S type, ISC system |
Gene: APA01_26000: ferredoxin, 2Fe-2S type, ISC system |
Gene: GOX1370: ferredoxin, 2Fe-2S type, ISC system |
Gene: GbCGDNIH1_1942: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
|
Gene: Magn03007591: putative Fe-S cluster assembly protein |
Gene: amb3022: putative Fe-S cluster assembly protein |
|
|
|
|
|
|
putative Fe-S cluster assembly protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |