Regulon of IscR in Rhodospirillum rubrum ATCC 11170

Properties
Regulator type:	Transcription factor
TF locus tag:	Rru_A2028
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 7 Sequence: ATTCTTGACCGATTTTCTCGGACAC Locus tag: Rru_A2029 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30) Locus tag: Rru_A2028 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Rru_A2027 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Rru_A2026 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Rru_A2029	cysE	Serine acetyltransferase (EC 2.3.1.30)
	Rru_A2028	iscR	Iron-sulfur cluster regulator IscR
	Rru_A2027	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Rru_A2026	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD