Regulon of IscR in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_020080
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -200 Score: 7 Sequence: ATTCTTGACCGTTTTGCTTGGTCAT Locus tag: AZL_020070 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30) Locus tag: AZL_020080 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: AZL_020090 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: AZL_020100 Name: hscB Funciton: Chaperone protein HscB Locus tag: AZL_020110 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	AZL_020070	cysE	Serine acetyltransferase (EC 2.3.1.30)
	AZL_020080	iscR	Iron-sulfur cluster regulator IscR
	AZL_020090	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	AZL_020100	hscB	Chaperone protein HscB
	AZL_020110	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD