Regulon of IscR in Magnetospirillum magneticum AMB-1

Properties
Regulator type:	Transcription factor
TF locus tag:	amb3030
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Rhodospirillales
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 7.3 Sequence: AATCTTGACTGGCCTTGTCGGACAT Locus tag: amb3031 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30) Locus tag: amb3030 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: amb3029 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: amb3028 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: amb3027 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: amb3026 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: amb3025 Name: hscB Funciton: Chaperone protein HscB Locus tag: amb3024 Name: hscA Funciton: Chaperone protein HscA Locus tag: amb3023 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: amb3022 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	amb3031	cysE	Serine acetyltransferase (EC 2.3.1.30)
	amb3030	iscR	Iron-sulfur cluster regulator IscR
	amb3029	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	amb3028	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	amb3027	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	amb3026	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	amb3025	hscB	Chaperone protein HscB
	amb3024	hscA	Chaperone protein HscA
	amb3023	fdx	ferredoxin, 2Fe-2S type, ISC system
	amb3022	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD