Regulon of IscR in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03007504
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Rhodospirillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -193 Score: 7.2 Sequence: AATCTTGACTGGCCTTGTCGGGCAT Locus tag: Magn03007535 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	Magn03007535	cysE	Serine acetyltransferase (EC 2.3.1.30)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD