Regulog IscR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	7	1
Acidovorax sp. JS42	7	1
Comamonas testosteroni KF-1	7	1
Delftia acidovorans SPH-1	7	1
Polaromonas naphthalenivorans CJ2	7	1
Polaromonas sp. JS666	7	1
Rhodoferax ferrireducens DSM 15236	7	1
Variovorax paradoxus S110	7	1
Verminephrobacter eiseniae EF01-2	7	1
Methylibium petroleiphilum PM1	7	1
Leptothrix cholodnii SP-6	7	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
iscR	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -207 score = 5.71904 sequence = TTACCCGACAAAAACAATAGGGTTT Site: position = -176 score = 5.42735 sequence = ATACTTGGGCGCAACACTCAAGAAA Gene: Aave_2442: Iron-sulfur cluster regulator IscR	* Acidovorax sp. JS42 Site: position = -189 score = 5.64608 sequence = TTACCCGATAAAATTAATAGGGATT Site: position = -158 score = 5.83281 sequence = ATACTTGTCTCAAATACTCAAGAAA Gene: Ajs_2145: Iron-sulfur cluster regulator IscR	* Comamonas testosteroni KF-1 Site: position = -182 score = 5.75193 sequence = TTACCCGACAAAATTGATGGGGAAT Site: position = -152 score = 5.62556 sequence = ATACTCGCGTCAAACACTCAACAAC Gene: CtesDRAFT_1260: Iron-sulfur cluster regulator IscR	* Delftia acidovorans SPH-1 Site: position = -192 score = 5.75193 sequence = TTACCCGACAAAATTGATGGGGAAT Gene: Daci_4000: Iron-sulfur cluster regulator IscR	* Polaromonas naphthalenivorans CJ2 Site: position = -152 score = 6.26727 sequence = ATACTTGACGAAATTAGTCAAGAAC Gene: Pnap_2291: Iron-sulfur cluster regulator IscR	* Polaromonas sp. JS666 Site: position = -154 score = 6.28806 sequence = ATACTTGACGAAAACAGTCAGGAAC Gene: Bpro_2177: Iron-sulfur cluster regulator IscR	* Rhodoferax ferrireducens DSM 15236 Site: position = -52 score = 5.5616 sequence = ATACTCAACTATATTAGTCAAGTAA Site: position = -82 score = 5.24473 sequence = TTACCCGAGTAAATTACTTGGTTTC Gene: Rfer_2176: Iron-sulfur cluster regulator IscR	* Variovorax paradoxus S110 Site: position = -165 score = 5.85685 sequence = ATACTTGAGCGAAATACTCAACAAC Site: position = -152 score = 5.41072 sequence = ATACTCAACAACAACAAAAAAGAAC Gene: Vapar_2141: Iron-sulfur cluster regulator IscR	* Verminephrobacter eiseniae EF01-2 Site: position = -216 score = 4.21891 sequence = TAATCCGACAAATTTGATAAGGATT Gene: Veis_2372: Iron-sulfur cluster regulator IscR	* Methylibium petroleiphilum PM1 Site: position = -98 score = 5.10354 sequence = ATAATTGAGCTATTCAGTCGGGATT Gene: Mpe_A2263: Iron-sulfur cluster regulator IscR	* Leptothrix cholodnii SP-6 Site: position = -109 score = 6.13658 sequence = ATAATCGAGTAAAACACTCGGGAAA Gene: Lcho_1048: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2443: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Acidovorax sp. JS42 Gene: Ajs_2144: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1261: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Delftia acidovorans SPH-1 Gene: Daci_3999: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2290: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Polaromonas sp. JS666 Gene: Bpro_2178: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2177: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Variovorax paradoxus S110 Gene: Vapar_2142: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Verminephrobacter eiseniae EF01-2 Gene: Veis_2373: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Methylibium petroleiphilum PM1 Gene: Mpe_A2262: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Leptothrix cholodnii SP-6 Gene: Lcho_1047: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2444: Iron-sulfur cluster assembly scaffold protein IscU	Acidovorax sp. JS42 Gene: Ajs_2143: Iron-sulfur cluster assembly scaffold protein IscU	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1262: Iron-sulfur cluster assembly scaffold protein IscU	Delftia acidovorans SPH-1 Gene: Daci_3998: Iron-sulfur cluster assembly scaffold protein IscU	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2289: Iron-sulfur cluster assembly scaffold protein IscU	Polaromonas sp. JS666 Gene: Bpro_2179: Iron-sulfur cluster assembly scaffold protein IscU	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2178: Iron-sulfur cluster assembly scaffold protein IscU	Variovorax paradoxus S110 Gene: Vapar_2143: Iron-sulfur cluster assembly scaffold protein IscU	Verminephrobacter eiseniae EF01-2 Gene: Veis_2374: Iron-sulfur cluster assembly scaffold protein IscU	Methylibium petroleiphilum PM1 Gene: Mpe_A2261: Iron-sulfur cluster assembly scaffold protein IscU	Leptothrix cholodnii SP-6 Gene: Lcho_1046: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2445: Iron binding protein IscA for iron-sulfur cluster assembly	Acidovorax sp. JS42 Gene: Ajs_2142: Iron binding protein IscA for iron-sulfur cluster assembly	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1263: Iron binding protein IscA for iron-sulfur cluster assembly	Delftia acidovorans SPH-1 Gene: Daci_3997: Iron binding protein IscA for iron-sulfur cluster assembly	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2288: Iron binding protein IscA for iron-sulfur cluster assembly	Polaromonas sp. JS666 Gene: Bpro_2180: Iron binding protein IscA for iron-sulfur cluster assembly	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2179: Iron binding protein IscA for iron-sulfur cluster assembly	Variovorax paradoxus S110 Gene: Vapar_2144: Iron binding protein IscA for iron-sulfur cluster assembly	Verminephrobacter eiseniae EF01-2 Gene: Veis_2375: Iron binding protein IscA for iron-sulfur cluster assembly	Methylibium petroleiphilum PM1 Gene: Mpe_A2260: Iron binding protein IscA for iron-sulfur cluster assembly	Leptothrix cholodnii SP-6 Gene: Lcho_1045: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2446: Chaperone protein HscB	Acidovorax sp. JS42 Gene: Ajs_2141: Chaperone protein HscB	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1264: Chaperone protein HscB	Delftia acidovorans SPH-1 Gene: Daci_3996: Chaperone protein HscB	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2287: Chaperone protein HscB	Polaromonas sp. JS666 Gene: Bpro_2181: Chaperone protein HscB	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2180: Chaperone protein HscB	Variovorax paradoxus S110 Gene: Vapar_2145: Chaperone protein HscB	Verminephrobacter eiseniae EF01-2 Gene: Veis_2376: Chaperone protein HscB	Methylibium petroleiphilum PM1 Gene: Mpe_A2259: Chaperone protein HscB	Leptothrix cholodnii SP-6 Gene: Lcho_1044: Chaperone protein HscB	Chaperone protein HscB
hscA	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2447: Chaperone protein HscA	Acidovorax sp. JS42 Gene: Ajs_2140: Chaperone protein HscA	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1265: Chaperone protein HscA	Delftia acidovorans SPH-1 Gene: Daci_3995: Chaperone protein HscA	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2286: Chaperone protein HscA	Polaromonas sp. JS666 Gene: Bpro_2182: Chaperone protein HscA	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2181: Chaperone protein HscA	Variovorax paradoxus S110 Gene: Vapar_2146: Chaperone protein HscA	Verminephrobacter eiseniae EF01-2 Gene: Veis_2377: Chaperone protein HscA	Methylibium petroleiphilum PM1 Gene: Mpe_A2258: Chaperone protein HscA	Leptothrix cholodnii SP-6 Gene: Lcho_1043: Chaperone protein HscA	Chaperone protein HscA
fdx	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2448: ferredoxin, 2Fe-2S type, ISC system	Acidovorax sp. JS42 Gene: Ajs_2139: ferredoxin, 2Fe-2S type, ISC system	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1266: ferredoxin, 2Fe-2S type, ISC system	Delftia acidovorans SPH-1 Gene: Daci_3994: ferredoxin, 2Fe-2S type, ISC system	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2285: ferredoxin, 2Fe-2S type, ISC system	Polaromonas sp. JS666 Gene: Bpro_2183: ferredoxin, 2Fe-2S type, ISC system	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2182: ferredoxin, 2Fe-2S type, ISC system	Variovorax paradoxus S110 Gene: Vapar_2147: ferredoxin, 2Fe-2S type, ISC system	Verminephrobacter eiseniae EF01-2 Gene: Veis_2378: ferredoxin, 2Fe-2S type, ISC system	Methylibium petroleiphilum PM1 Gene: Mpe_A2257: ferredoxin, 2Fe-2S type, ISC system	Leptothrix cholodnii SP-6 Gene: Lcho_1042: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --