Regulog IscR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 7 | 1 |
| Acidovorax sp. JS42 | 7 | 1 |
| Comamonas testosteroni KF-1 | 7 | 1 |
| Delftia acidovorans SPH-1 | 7 | 1 |
| Polaromonas naphthalenivorans CJ2 | 7 | 1 |
| Polaromonas sp. JS666 | 7 | 1 |
| Rhodoferax ferrireducens DSM 15236 | 7 | 1 |
| Variovorax paradoxus S110 | 7 | 1 |
| Verminephrobacter eiseniae EF01-2 | 7 | 1 |
| Methylibium petroleiphilum PM1 | 7 | 1 |
| Leptothrix cholodnii SP-6 | 7 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| iscR |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -207 score = 5.71904 sequence = TTACCCGACAAAAACAATAGGGTTT Site: position = -176 score = 5.42735 sequence = ATACTTGGGCGCAACACTCAAGAAA Gene: Aave_2442: Iron-sulfur cluster regulator IscR |
*
Acidovorax sp. JS42 Site: position = -189 score = 5.64608 sequence = TTACCCGATAAAATTAATAGGGATT Site: position = -158 score = 5.83281 sequence = ATACTTGTCTCAAATACTCAAGAAA Gene: Ajs_2145: Iron-sulfur cluster regulator IscR |
*
Comamonas testosteroni KF-1 Site: position = -182 score = 5.75193 sequence = TTACCCGACAAAATTGATGGGGAAT Site: position = -152 score = 5.62556 sequence = ATACTCGCGTCAAACACTCAACAAC Gene: CtesDRAFT_1260: Iron-sulfur cluster regulator IscR |
*
Delftia acidovorans SPH-1 Site: position = -192 score = 5.75193 sequence = TTACCCGACAAAATTGATGGGGAAT Gene: Daci_4000: Iron-sulfur cluster regulator IscR |
*
Polaromonas naphthalenivorans CJ2 Site: position = -152 score = 6.26727 sequence = ATACTTGACGAAATTAGTCAAGAAC Gene: Pnap_2291: Iron-sulfur cluster regulator IscR |
*
Polaromonas sp. JS666 Site: position = -154 score = 6.28806 sequence = ATACTTGACGAAAACAGTCAGGAAC Gene: Bpro_2177: Iron-sulfur cluster regulator IscR |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -52 score = 5.5616 sequence = ATACTCAACTATATTAGTCAAGTAA Site: position = -82 score = 5.24473 sequence = TTACCCGAGTAAATTACTTGGTTTC Gene: Rfer_2176: Iron-sulfur cluster regulator IscR |
*
Variovorax paradoxus S110 Site: position = -165 score = 5.85685 sequence = ATACTTGAGCGAAATACTCAACAAC Site: position = -152 score = 5.41072 sequence = ATACTCAACAACAACAAAAAAGAAC Gene: Vapar_2141: Iron-sulfur cluster regulator IscR |
*
Verminephrobacter eiseniae EF01-2 Site: position = -216 score = 4.21891 sequence = TAATCCGACAAATTTGATAAGGATT Gene: Veis_2372: Iron-sulfur cluster regulator IscR |
*
Methylibium petroleiphilum PM1 Site: position = -98 score = 5.10354 sequence = ATAATTGAGCTATTCAGTCGGGATT Gene: Mpe_A2263: Iron-sulfur cluster regulator IscR |
*
Leptothrix cholodnii SP-6 Site: position = -109 score = 6.13658 sequence = ATAATCGAGTAAAACACTCGGGAAA Gene: Lcho_1048: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: Aave_2443: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Ajs_2144: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: CtesDRAFT_1261: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Daci_3999: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Pnap_2290: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bpro_2178: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Rfer_2177: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Vapar_2142: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Veis_2373: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Mpe_A2262: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Lcho_1047: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: Aave_2444: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Ajs_2143: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: CtesDRAFT_1262: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Daci_3998: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Pnap_2289: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bpro_2179: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Rfer_2178: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Vapar_2143: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Veis_2374: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Mpe_A2261: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Lcho_1046: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: Aave_2445: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Ajs_2142: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: CtesDRAFT_1263: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Daci_3997: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Pnap_2288: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bpro_2180: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Rfer_2179: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Vapar_2144: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Veis_2375: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Mpe_A2260: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Lcho_1045: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: Aave_2446: Chaperone protein HscB |
Gene: Ajs_2141: Chaperone protein HscB |
Gene: CtesDRAFT_1264: Chaperone protein HscB |
Gene: Daci_3996: Chaperone protein HscB |
Gene: Pnap_2287: Chaperone protein HscB |
Gene: Bpro_2181: Chaperone protein HscB |
Gene: Rfer_2180: Chaperone protein HscB |
Gene: Vapar_2145: Chaperone protein HscB |
Gene: Veis_2376: Chaperone protein HscB |
Gene: Mpe_A2259: Chaperone protein HscB |
Gene: Lcho_1044: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: Aave_2447: Chaperone protein HscA |
Gene: Ajs_2140: Chaperone protein HscA |
Gene: CtesDRAFT_1265: Chaperone protein HscA |
Gene: Daci_3995: Chaperone protein HscA |
Gene: Pnap_2286: Chaperone protein HscA |
Gene: Bpro_2182: Chaperone protein HscA |
Gene: Rfer_2181: Chaperone protein HscA |
Gene: Vapar_2146: Chaperone protein HscA |
Gene: Veis_2377: Chaperone protein HscA |
Gene: Mpe_A2258: Chaperone protein HscA |
Gene: Lcho_1043: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: Aave_2448: ferredoxin, 2Fe-2S type, ISC system |
Gene: Ajs_2139: ferredoxin, 2Fe-2S type, ISC system |
Gene: CtesDRAFT_1266: ferredoxin, 2Fe-2S type, ISC system |
Gene: Daci_3994: ferredoxin, 2Fe-2S type, ISC system |
Gene: Pnap_2285: ferredoxin, 2Fe-2S type, ISC system |
Gene: Bpro_2183: ferredoxin, 2Fe-2S type, ISC system |
Gene: Rfer_2182: ferredoxin, 2Fe-2S type, ISC system |
Gene: Vapar_2147: ferredoxin, 2Fe-2S type, ISC system |
Gene: Veis_2378: ferredoxin, 2Fe-2S type, ISC system |
Gene: Mpe_A2257: ferredoxin, 2Fe-2S type, ISC system |
Gene: Lcho_1042: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |