Regulon of IscR in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_1048
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6.1 Sequence: ATAATCGAGTAAAACACTCGGGAAA Locus tag: Lcho_1048 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Lcho_1047 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Lcho_1046 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Lcho_1045 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Lcho_1044 Name: hscB Funciton: Chaperone protein HscB Locus tag: Lcho_1043 Name: hscA Funciton: Chaperone protein HscA Locus tag: Lcho_1042 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Lcho_1048	iscR	Iron-sulfur cluster regulator IscR
	Lcho_1047	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Lcho_1046	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Lcho_1045	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Lcho_1044	hscB	Chaperone protein HscB
	Lcho_1043	hscA	Chaperone protein HscA
	Lcho_1042	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD