Regulon of IscR in Polaromonas sp. JS666

Properties
Regulator type:	Transcription factor
TF locus tag:	Bpro_2177
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 6.3 Sequence: ATACTTGACGAAAACAGTCAGGAAC Locus tag: Bpro_2177 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Bpro_2178 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Bpro_2179 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Bpro_2180 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Bpro_2181 Name: hscB Funciton: Chaperone protein HscB Locus tag: Bpro_2182 Name: hscA Funciton: Chaperone protein HscA Locus tag: Bpro_2183 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Bpro_2177	iscR	Iron-sulfur cluster regulator IscR
	Bpro_2178	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Bpro_2179	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Bpro_2180	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Bpro_2181	hscB	Chaperone protein HscB
	Bpro_2182	hscA	Chaperone protein HscA
	Bpro_2183	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD