Regulon of IscR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A2263
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 5.1 Sequence: ATAATTGAGCTATTCAGTCGGGATT Locus tag: Mpe_A2263 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Mpe_A2262 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Mpe_A2261 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Mpe_A2260 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Mpe_A2259 Name: hscB Funciton: Chaperone protein HscB Locus tag: Mpe_A2258 Name: hscA Funciton: Chaperone protein HscA Locus tag: Mpe_A2257 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Mpe_A2263	iscR	Iron-sulfur cluster regulator IscR
	Mpe_A2262	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Mpe_A2261	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Mpe_A2260	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Mpe_A2259	hscB	Chaperone protein HscB
	Mpe_A2258	hscA	Chaperone protein HscA
	Mpe_A2257	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD