Regulon of IscR in Acidovorax sp. JS42

Properties
Regulator type:	Transcription factor
TF locus tag:	Ajs_2145
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -189 Score: 5.6 Sequence: TTACCCGATAAAATTAATAGGGATT Position: -158 Score: 5.8 Sequence: ATACTTGTCTCAAATACTCAAGAAA Locus tag: Ajs_2145 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Ajs_2144 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Ajs_2143 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Ajs_2142 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Ajs_2141 Name: hscB Funciton: Chaperone protein HscB Locus tag: Ajs_2140 Name: hscA Funciton: Chaperone protein HscA Locus tag: Ajs_2139 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Ajs_2145	iscR	Iron-sulfur cluster regulator IscR
	Ajs_2144	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Ajs_2143	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Ajs_2142	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Ajs_2141	hscB	Chaperone protein HscB
	Ajs_2140	hscA	Chaperone protein HscA
	Ajs_2139	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD