Regulog IscR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 9 | 2 |
| Psychromonas sp. CNPT3 | 9 | 2 |
| Moritella sp. PE36 | 9 | 2 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 8 | 2 |
| Aeromonas salmonicida subsp. salmonicida A449 | 9 | 2 |
| Tolumonas auensis DSM 9187 | 8 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| iscR |
*
Psychromonas ingrahamii 37 Site: position = -106 score = 6.94469 sequence = TTACTTGACTATTTTTGTCAGGTAT Site: position = -133 score = 6.70842 sequence = TTACCTGACTATTTTTGTCAGGTAT Gene: Ping_1323: Iron-sulfur cluster regulator IscR |
*
Psychromonas sp. CNPT3 Site: position = -99 score = 6.90697 sequence = TTAGTTGACTAATTTAGTAGGGTAT Gene: PCNPT3_05479: Iron-sulfur cluster regulator IscR |
*
Moritella sp. PE36 Site: position = -62 score = 7.115 sequence = ATACTTGACCATTTCAGTCGGGTAT Site: position = -87 score = 6.89047 sequence = ATACCTGAGTAAATTAGTCAGGTAT Gene: PE36_21624: Iron-sulfur cluster regulator IscR |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -70 score = 7.4528 sequence = ATACTTGACTGATTTAGTCGGGTAT Gene: AHA_1746: Iron-sulfur cluster regulator IscR |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -70 score = 7.37361 sequence = ATACTTGACTGTTTTAGTCGGGTAT Gene: ASA_2613: Iron-sulfur cluster regulator IscR |
*
Tolumonas auensis DSM 9187 Site: position = -56 score = 6.06912 sequence = ATACTTGACTGAAAAAGTAGGACAT Gene: Tola_2020: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: Ping_1324: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PCNPT3_05484: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PE36_21619: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: AHA_1747: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: ASA_2612: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Tola_2019: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: Ping_1325: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PCNPT3_05489: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PE36_21614: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: AHA_1748: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: ASA_2611: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Tola_2018: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: Ping_1326: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PCNPT3_05494: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PE36_21609: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: AHA_1749: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: ASA_2610: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Tola_2017: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: Ping_1327: Chaperone protein HscB |
Gene: PCNPT3_05499: Chaperone protein HscB |
Gene: PE36_21604: Chaperone protein HscB |
Gene: AHA_1750: Chaperone protein HscB |
Gene: ASA_2608: Chaperone protein HscB |
Gene: Tola_2016: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: Ping_1328: Chaperone protein HscA |
Gene: PCNPT3_05504: Chaperone protein HscA |
Gene: PE36_21599: Chaperone protein HscA |
Gene: AHA_1751: Chaperone protein HscA |
Gene: ASA_2607: Chaperone protein HscA |
Gene: Tola_2015: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: Ping_1329: ferredoxin, 2Fe-2S type, ISC system |
Gene: PCNPT3_05509: ferredoxin, 2Fe-2S type, ISC system |
Gene: PE36_21594: ferredoxin, 2Fe-2S type, ISC system |
Gene: AHA_1752: ferredoxin, 2Fe-2S type, ISC system |
Gene: ASA_2606: ferredoxin, 2Fe-2S type, ISC system |
Gene: Tola_2014: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: Ping_1330: putative Fe-S cluster assembly protein |
Gene: PCNPT3_05514: putative Fe-S cluster assembly protein |
Gene: PE36_21589: putative Fe-S cluster assembly protein |
|
|
|
putative Fe-S cluster assembly protein |
| ASA_2609 |
|
|
|
|
Gene: ASA_2609: Hypothetical protein |
|
Hypothetical protein |
| CRON 2. | |||||||
| erpA |
*
Psychromonas ingrahamii 37 Site: position = -65 score = 6.69408 sequence = ATACTTGAACTAATTAGTCAGGTAC Gene: Ping_0867: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Psychromonas sp. CNPT3 Site: position = -63 score = 7.09409 sequence = ATAGTTGAACTAATTAGTCGGGTAT Gene: PCNPT3_04157: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Moritella sp. PE36 Site: position = -67 score = 7.19272 sequence = ATAGTTGACTGAATTAGTCAGGTAT Gene: PE36_05088: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -24 score = 6.62404 sequence = ATACTTGAACTGAATGGTCGGGTAT Gene: AHA_3517: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -78 score = 6.87196 sequence = ATACTTGAACTAAACAGTCGGGTAT Gene: ASA_0800: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Tolumonas auensis DSM 9187 Site: position = -94 score = 7.04922 sequence = ATACTTGAACTGTTTAGTCAGGTAT Gene: Tola_0580: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |