Regulon of IscR in Aeromonas hydrophila subsp. hydrophila ATCC 7966

Properties
Regulator type:	Transcription factor
TF locus tag:	AHA_1746
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -24 Score: 6.6 Sequence: ATACTTGAACTGAATGGTCGGGTAT Locus tag: AHA_3517 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	AHA_3517	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -70 Score: 7.5 Sequence: ATACTTGACTGATTTAGTCGGGTAT Locus tag: AHA_1746 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: AHA_1747 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: AHA_1748 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: AHA_1749 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: AHA_1750 Name: hscB Funciton: Chaperone protein HscB Locus tag: AHA_1751 Name: hscA Funciton: Chaperone protein HscA Locus tag: AHA_1752 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	AHA_1746	iscR	Iron-sulfur cluster regulator IscR
	AHA_1747	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	AHA_1748	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	AHA_1749	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	AHA_1750	hscB	Chaperone protein HscB
	AHA_1751	hscA	Chaperone protein HscA
	AHA_1752	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD