Regulon of IscR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_21624
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.9 Sequence: ATACCTGAGTAAATTAGTCAGGTAT Position: -62 Score: 7.1 Sequence: ATACTTGACCATTTCAGTCGGGTAT Locus tag: PE36_21624 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: PE36_21619 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: PE36_21614 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: PE36_21609 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: PE36_21604 Name: hscB Funciton: Chaperone protein HscB Locus tag: PE36_21599 Name: hscA Funciton: Chaperone protein HscA Locus tag: PE36_21594 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: PE36_21589 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	PE36_21624	iscR	Iron-sulfur cluster regulator IscR
	PE36_21619	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	PE36_21614	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	PE36_21609	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	PE36_21604	hscB	Chaperone protein HscB
	PE36_21599	hscA	Chaperone protein HscA
	PE36_21594	fdx	ferredoxin, 2Fe-2S type, ISC system
	PE36_21589	yfhJ	putative Fe-S cluster assembly protein
Position: -67 Score: 7.2 Sequence: ATAGTTGACTGAATTAGTCAGGTAT Locus tag: PE36_05088 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	PE36_05088	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD