Orthologous regulated operons containing ASA_2609 gene

Properties
Regulog:	IscR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas salmonicida subsp. salmonicida A449
Position: -70 Score: 7.37361 Sequence: ATACTTGACTGTTTTAGTCGGGTAT Locus tag: ASA_2613 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ASA_2612 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ASA_2611 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: ASA_2610 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: ASA_2609 Name: ASA_2609 Funciton: Hypothetical protein Locus tag: ASA_2608 Name: hscB Funciton: Chaperone protein HscB Locus tag: ASA_2607 Name: hscA Funciton: Chaperone protein HscA Locus tag: ASA_2606 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-ASA_2609-hscB-hscA-fdx	-70	7.4	ATACTTGACTGTTTTAGTCGGGTAT	ASA_2613

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --